Incidental Mutation 'IGL03052:Mrgprb3'
ID392180
Institutional Source Beutler Lab
Gene Symbol Mrgprb3
Ensembl Gene ENSMUSG00000070546
Gene NameMAS-related GPR, member B3
SynonymsMrgB3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #IGL03052 (G1)
Quality Score152
Status Validated
Chromosome7
Chromosomal Location48642803-48643811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48643593 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 70 (V70E)
Ref Sequence ENSEMBL: ENSMUSP00000091945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094383
AA Change: V70E

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091945
Gene: ENSMUSG00000070546
AA Change: V70E

DomainStartEndE-ValueType
SCOP:d1l9ha_ 25 279 4e-13 SMART
low complexity region 301 312 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Ccdc73 C A 2: 104,951,936 H212Q possibly damaging Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Cyp2c67 T C 19: 39,648,885 D49G possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Ddhd1 A G 14: 45,620,783 V164A probably damaging Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Olfr843 A T 9: 19,248,642 Y252* probably null Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vmn2r79 A T 7: 87,003,591 E497V probably benign Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Mrgprb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03069:Mrgprb3 APN 7 48643450 missense possibly damaging 0.71
Reserve UTSW 7 48643699 missense probably benign 0.02
starker UTSW 7 48643368 missense probably benign 0.28
R0446:Mrgprb3 UTSW 7 48643236 missense probably benign 0.42
R0546:Mrgprb3 UTSW 7 48643515 missense probably damaging 1.00
R0885:Mrgprb3 UTSW 7 48643096 missense probably damaging 1.00
R1764:Mrgprb3 UTSW 7 48643023 missense probably benign 0.01
R2044:Mrgprb3 UTSW 7 48643734 missense possibly damaging 0.92
R2230:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2232:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2240:Mrgprb3 UTSW 7 48643641 missense probably damaging 0.99
R3001:Mrgprb3 UTSW 7 48643484 missense probably benign
R3002:Mrgprb3 UTSW 7 48643484 missense probably benign
R4717:Mrgprb3 UTSW 7 48643252 missense probably benign 0.01
R4805:Mrgprb3 UTSW 7 48643306 missense probably benign 0.01
R5083:Mrgprb3 UTSW 7 48643014 missense probably benign 0.01
R5311:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R5330:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5331:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5615:Mrgprb3 UTSW 7 48643486 missense probably benign 0.01
R5621:Mrgprb3 UTSW 7 48643368 missense probably benign 0.28
R5697:Mrgprb3 UTSW 7 48642925 missense probably damaging 0.96
R5725:Mrgprb3 UTSW 7 48643800 start codon destroyed probably null 0.02
R5758:Mrgprb3 UTSW 7 48643319 missense probably benign 0.01
R5807:Mrgprb3 UTSW 7 48643362 missense probably benign 0.02
R5908:Mrgprb3 UTSW 7 48643618 missense probably damaging 0.98
R6902:Mrgprb3 UTSW 7 48643699 missense probably benign 0.02
R7037:Mrgprb3 UTSW 7 48643194 missense probably damaging 1.00
R7288:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R7605:Mrgprb3 UTSW 7 48643114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGATGGGCCACATGATAG -3'
(R):5'- AGCATGGCTCTAAGAACCTC -3'

Sequencing Primer
(F):5'- TAGACAGGCAGCACTCAATG -3'
(R):5'- TGGCTCTAAGAACCTCACTAATAAC -3'
Posted On2016-06-09