Incidental Mutation 'IGL03052:Olfr843'
ID392187
Institutional Source Beutler Lab
Gene Symbol Olfr843
Ensembl Gene ENSMUSG00000048391
Gene Nameolfactory receptor 843
SynonymsGA_x6K02T2PVTD-12986331-12985390, MOR155-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #IGL03052 (G1)
Quality Score68
Status Validated
Chromosome9
Chromosomal Location19242956-19251987 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19248642 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 252 (Y252*)
Ref Sequence ENSEMBL: ENSMUSP00000151203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061365] [ENSMUST00000214019] [ENSMUST00000214267]
Predicted Effect probably null
Transcript: ENSMUST00000061365
AA Change: Y252*
SMART Domains Protein: ENSMUSP00000051027
Gene: ENSMUSG00000048391
AA Change: Y252*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-51 PFAM
Pfam:7tm_1 41 290 3.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214019
AA Change: Y252*
Predicted Effect probably null
Transcript: ENSMUST00000214267
AA Change: Y252*
Meta Mutation Damage Score 0.9665 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Ccdc73 C A 2: 104,951,936 H212Q possibly damaging Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Cyp2c67 T C 19: 39,648,885 D49G possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Ddhd1 A G 14: 45,620,783 V164A probably damaging Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mrgprb3 A T 7: 48,643,593 V70E possibly damaging Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vmn2r79 A T 7: 87,003,591 E497V probably benign Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Olfr843
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr843 APN 9 19248870 missense probably benign 0.21
IGL02338:Olfr843 APN 9 19248664 missense probably damaging 0.98
IGL03197:Olfr843 APN 9 19248802 missense probably benign 0.37
IGL03227:Olfr843 APN 9 19249222 missense probably damaging 1.00
IGL03046:Olfr843 UTSW 9 19249145 missense probably damaging 0.99
R0423:Olfr843 UTSW 9 19248952 nonsense probably null
R1316:Olfr843 UTSW 9 19248739 missense probably benign 0.06
R1759:Olfr843 UTSW 9 19249088 missense probably benign 0.36
R1782:Olfr843 UTSW 9 19248581 missense probably benign 0.04
R2517:Olfr843 UTSW 9 19249061 missense probably benign 0.21
R3196:Olfr843 UTSW 9 19249199 missense probably damaging 1.00
R3742:Olfr843 UTSW 9 19248683 missense possibly damaging 0.91
R4191:Olfr843 UTSW 9 19249087 missense probably benign 0.05
R4320:Olfr843 UTSW 9 19248756 missense probably damaging 1.00
R4523:Olfr843 UTSW 9 19249229 missense probably damaging 0.98
R4756:Olfr843 UTSW 9 19248857 missense possibly damaging 0.56
R4908:Olfr843 UTSW 9 19248853 missense probably benign 0.00
R5319:Olfr843 UTSW 9 19249033 missense possibly damaging 0.60
R5554:Olfr843 UTSW 9 19248743 missense probably benign 0.02
R6011:Olfr843 UTSW 9 19248511 missense probably damaging 0.98
R7330:Olfr843 UTSW 9 19249271 missense probably benign 0.01
R7862:Olfr843 UTSW 9 19249440 start gained probably benign
R7945:Olfr843 UTSW 9 19249440 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTATGGAGATGATAAGACCACAGG -3'
(R):5'- TTGTTCAAGTCATCAAACATGCCTG -3'

Sequencing Primer
(F):5'- CCACAGGAAAGAGAAGGTGTC -3'
(R):5'- AGTCATCAAACATGCCTGCTCTG -3'
Posted On2016-06-09