Incidental Mutation 'IGL03052:Cyp2c67'
ID392208
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #IGL03052 (G1)
Quality Score224
Status Validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39648885 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067328
AA Change: D49G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: D49G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Meta Mutation Damage Score 0.3958 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Ccdc73 C A 2: 104,951,936 H212Q possibly damaging Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Ddhd1 A G 14: 45,620,783 V164A probably damaging Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mrgprb3 A T 7: 48,643,593 V70E possibly damaging Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Olfr843 A T 9: 19,248,642 Y252* probably null Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vmn2r79 A T 7: 87,003,591 E497V probably benign Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGCATTTCAGAGTCTTCAATCTG -3'
(R):5'- ATACCTGTGTCAGTAAGAGGGG -3'

Sequencing Primer
(F):5'- CTCATTTCCTGATCAGAACTAGAGGC -3'
(R):5'- TAAGAGGGGTCTCCATGGATCC -3'
Posted On2016-06-09