Incidental Mutation 'IGL03052:Cyp2c67'
ID 392208
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # IGL03052 (G1)
Quality Score 224
Status Validated
Chromosome 19
Chromosomal Location 39597288-39637497 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39637329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect possibly damaging
Transcript: ENSMUST00000067328
AA Change: D49G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: D49G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Meta Mutation Damage Score 0.3958 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T C 4: 155,987,815 (GRCm39) F517S probably damaging Het
Afap1l1 A G 18: 61,881,894 (GRCm39) V267A probably benign Het
Asap1 A G 15: 64,025,683 (GRCm39) probably benign Het
Bcl6 T C 16: 23,793,788 (GRCm39) probably benign Het
Ccdc73 C A 2: 104,782,281 (GRCm39) H212Q possibly damaging Het
Cct5 A T 15: 31,597,633 (GRCm39) H85Q probably damaging Het
Cfap69 A C 5: 5,639,206 (GRCm39) L238R probably damaging Het
Chl1 A T 6: 103,668,628 (GRCm39) T470S probably benign Het
Cnga4 T C 7: 105,053,932 (GRCm39) S12P probably benign Het
Cyp2c29 C T 19: 39,275,662 (GRCm39) T34M possibly damaging Het
Dab2ip A G 2: 35,533,909 (GRCm39) Q45R probably benign Het
Ddhd1 A G 14: 45,858,240 (GRCm39) V164A probably damaging Het
Dnaaf8 A T 16: 4,795,358 (GRCm39) noncoding transcript Het
Dnah7c A G 1: 46,671,309 (GRCm39) Y1566C probably damaging Het
Dnase1l2 T C 17: 24,659,968 (GRCm39) probably benign Het
Dock2 G T 11: 34,182,853 (GRCm39) N1593K probably benign Het
Dpp6 G T 5: 27,914,506 (GRCm39) M530I probably benign Het
Epm2a T C 10: 11,332,974 (GRCm39) V269A possibly damaging Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Fgf2 A G 3: 37,403,161 (GRCm39) S55G probably benign Het
Frem3 C T 8: 81,341,159 (GRCm39) P1151S probably damaging Het
Gm15737 T C 6: 92,846,481 (GRCm39) probably benign Het
Gpi-ps T A 8: 5,689,816 (GRCm39) noncoding transcript Het
Gvin-ps6 T C 7: 106,022,902 (GRCm39) noncoding transcript Het
Hoxa3 G A 6: 52,147,267 (GRCm39) probably benign Het
Larp7-ps A G 4: 92,079,287 (GRCm39) L178P probably benign Het
Macf1 T C 4: 123,281,188 (GRCm39) I3770V probably damaging Het
Mapk15 G T 15: 75,865,731 (GRCm39) R8L probably benign Het
Mecom C T 3: 30,015,112 (GRCm39) probably benign Het
Mknk2 C T 10: 80,505,496 (GRCm39) R154H probably benign Het
Mrgprb3 A T 7: 48,293,341 (GRCm39) V70E possibly damaging Het
Mtdh A G 15: 34,140,876 (GRCm39) K570E possibly damaging Het
Myo5c G T 9: 75,159,798 (GRCm39) probably benign Het
Myom2 T C 8: 15,173,442 (GRCm39) probably benign Het
Or52m2 C T 7: 102,263,656 (GRCm39) R180Q probably benign Het
Or5b124 T C 19: 13,611,090 (GRCm39) I205T probably benign Het
Or7g25 A T 9: 19,159,938 (GRCm39) Y252* probably null Het
Pcca A T 14: 123,124,513 (GRCm39) M695L probably benign Het
Pcdha2 A T 18: 37,074,670 (GRCm39) D767V probably damaging Het
Plekhs1 G A 19: 56,459,189 (GRCm39) D16N probably benign Het
Prr11 T C 11: 86,994,478 (GRCm39) N56S possibly damaging Het
Rxfp2 A T 5: 149,966,645 (GRCm39) probably benign Het
Sacs G T 14: 61,445,307 (GRCm39) G2451V probably damaging Het
Scarb1 G A 5: 125,371,163 (GRCm39) A4V probably damaging Het
Scart2 G A 7: 139,828,827 (GRCm39) C162Y probably damaging Het
Sik3 C A 9: 46,109,447 (GRCm39) T475K probably damaging Het
Slco1b2 A T 6: 141,594,311 (GRCm39) I59L probably benign Het
Sspo G A 6: 48,437,387 (GRCm39) G1382R probably damaging Het
Stx16 C A 2: 173,934,231 (GRCm39) P145T probably benign Het
Tnrc18 G A 5: 142,760,974 (GRCm39) A674V unknown Het
Uqcrq A G 11: 53,321,476 (GRCm39) V14A possibly damaging Het
Vmn2r79 A T 7: 86,652,799 (GRCm39) E497V probably benign Het
Vps8 T A 16: 21,267,115 (GRCm39) I166K probably damaging Het
Vwa8 A G 14: 79,302,361 (GRCm39) D1010G probably benign Het
Wnk1 T A 6: 119,921,760 (GRCm39) probably benign Het
Zfand3 T A 17: 30,279,798 (GRCm39) M29K probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39,631,829 (GRCm39) missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39,628,376 (GRCm39) nonsense probably null
IGL01363:Cyp2c67 APN 19 39,628,411 (GRCm39) missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39,604,165 (GRCm39) missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39,637,470 (GRCm39) missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39,637,446 (GRCm39) missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02355:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02358:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02362:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02388:Cyp2c67 APN 19 39,631,799 (GRCm39) missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39,632,119 (GRCm39) missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39,631,738 (GRCm39) missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39,631,713 (GRCm39) critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39,632,128 (GRCm39) missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39,628,405 (GRCm39) missense probably damaging 1.00
R0585:Cyp2c67 UTSW 19 39,627,138 (GRCm39) missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39,597,622 (GRCm39) missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39,631,818 (GRCm39) missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39,614,585 (GRCm39) missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39,627,069 (GRCm39) missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39,627,035 (GRCm39) missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39,637,408 (GRCm39) missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1613:Cyp2c67 UTSW 19 39,614,643 (GRCm39) missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1667:Cyp2c67 UTSW 19 39,632,034 (GRCm39) critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39,605,811 (GRCm39) missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39,631,789 (GRCm39) missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39,614,681 (GRCm39) missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39,597,541 (GRCm39) missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39,627,127 (GRCm39) missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39,632,098 (GRCm39) missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39,627,032 (GRCm39) missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39,632,188 (GRCm39) missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39,604,168 (GRCm39) missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39,627,132 (GRCm39) missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39,614,676 (GRCm39) missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39,604,094 (GRCm39) missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39,605,879 (GRCm39) missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39,605,873 (GRCm39) missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39,605,854 (GRCm39) nonsense probably null
R6939:Cyp2c67 UTSW 19 39,631,778 (GRCm39) missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39,604,123 (GRCm39) missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39,628,341 (GRCm39) missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39,605,783 (GRCm39) missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39,628,451 (GRCm39) nonsense probably null
R7337:Cyp2c67 UTSW 19 39,597,708 (GRCm39) splice site probably null
R7474:Cyp2c67 UTSW 19 39,605,876 (GRCm39) missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39,604,084 (GRCm39) missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39,597,669 (GRCm39) missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39,628,452 (GRCm39) missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39,627,118 (GRCm39) missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39,627,155 (GRCm39) missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39,614,605 (GRCm39) missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39,627,178 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39,632,123 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGCATTTCAGAGTCTTCAATCTG -3'
(R):5'- ATACCTGTGTCAGTAAGAGGGG -3'

Sequencing Primer
(F):5'- CTCATTTCCTGATCAGAACTAGAGGC -3'
(R):5'- TAAGAGGGGTCTCCATGGATCC -3'
Posted On 2016-06-09