Incidental Mutation 'IGL03047:Cdk2ap1'
ID392227
Institutional Source Beutler Lab
Gene Symbol Cdk2ap1
Ensembl Gene ENSMUSG00000029394
Gene NameCDK2 (cyclin-dependent kinase 2)-associated protein 1
SynonymsDORC1, p12, Doc1, ST19
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03047 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124345417-124363082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124348690 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 63 (A63E)
Ref Sequence ENSEMBL: ENSMUSP00000031341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031341] [ENSMUST00000111472] [ENSMUST00000111473] [ENSMUST00000111474] [ENSMUST00000196910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031341
AA Change: A63E

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031341
Gene: ENSMUSG00000029394
AA Change: A63E

DomainStartEndE-ValueType
Pfam:CDK2AP 3 113 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111472
AA Change: A36E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107097
Gene: ENSMUSG00000029394
AA Change: A36E

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111473
AA Change: A36E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107098
Gene: ENSMUSG00000029394
AA Change: A36E

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111474
AA Change: A36E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107099
Gene: ENSMUSG00000029394
AA Change: A36E

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196910
AA Change: A36E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143268
Gene: ENSMUSG00000029394
AA Change: A36E

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Meta Mutation Damage Score 0.2261 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mic homozygous for a knock-out allele die between E3.5 and E5.5 with rare survivors exhibiting craniofacial defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Ccr7 C T 11: 99,145,334 R254H probably benign Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp2c68 T G 19: 39,734,460 I215L probably benign Het
Cyp4f17 T A 17: 32,524,049 I232K possibly damaging Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 V938E probably damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Tm9sf4 A G 2: 153,161,406 probably benign Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Cdk2ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:Cdk2ap1 APN 5 124350179 splice site probably benign
IGL01979:Cdk2ap1 APN 5 124348709 missense probably damaging 1.00
IGL03240:Cdk2ap1 APN 5 124346144 missense probably damaging 1.00
R2159:Cdk2ap1 UTSW 5 124348604 nonsense probably null
R7144:Cdk2ap1 UTSW 5 124354358 missense probably damaging 0.99
V1662:Cdk2ap1 UTSW 5 124348676 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GACCAACTAGTGCTTCCCCTAG -3'
(R):5'- GGACCTTTTACCCTACTCTGGAG -3'

Sequencing Primer
(F):5'- AGGAAACCCCTTAGCCTTTACTG -3'
(R):5'- ACCCTACTCTGGAGTTATCTATGGG -3'
Posted On2016-06-09