Incidental Mutation 'IGL03047:Ccr7'
ID392236
Institutional Source Beutler Lab
Gene Symbol Ccr7
Ensembl Gene ENSMUSG00000037944
Gene Namechemokine (C-C motif) receptor 7
SynonymsEBI1, Ebi1h, Cmkbr7, CD197
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #IGL03047 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location99144196-99155077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99145334 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 254 (R254H)
Ref Sequence ENSEMBL: ENSMUSP00000099423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103134]
Predicted Effect probably benign
Transcript: ENSMUST00000103134
AA Change: R254H

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099423
Gene: ENSMUSG00000037944
AA Change: R254H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 75 326 1.8e-49 PFAM
Meta Mutation Damage Score 0.2248 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice exhibit an impaired primary immune response. Dendritic cells, B, T and T regulatory cells show impaired migration to the lymph nodes and secondary lymph organs exhibit morphological abnormalities. Lymphocytic infiltrates to the pancreas, lung and stomach are observed in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Cdk2ap1 G T 5: 124,348,690 A63E possibly damaging Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp2c68 T G 19: 39,734,460 I215L probably benign Het
Cyp4f17 T A 17: 32,524,049 I232K possibly damaging Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 V938E probably damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Tm9sf4 A G 2: 153,161,406 probably benign Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Ccr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Ccr7 APN 11 99145145 missense probably benign 0.45
lanzhou UTSW 11 99145277 missense possibly damaging 0.90
R0707:Ccr7 UTSW 11 99145983 missense probably damaging 1.00
R1115:Ccr7 UTSW 11 99145277 missense possibly damaging 0.90
R1664:Ccr7 UTSW 11 99145691 missense possibly damaging 0.90
R2291:Ccr7 UTSW 11 99145335 missense probably damaging 1.00
R3743:Ccr7 UTSW 11 99145207 missense possibly damaging 0.86
R4108:Ccr7 UTSW 11 99145378 missense probably damaging 1.00
R4214:Ccr7 UTSW 11 99145046 missense probably damaging 0.98
R5402:Ccr7 UTSW 11 99145734 missense possibly damaging 0.93
R5602:Ccr7 UTSW 11 99145489 missense probably benign 0.08
R6275:Ccr7 UTSW 11 99145663 missense probably damaging 1.00
R6991:Ccr7 UTSW 11 99145304 missense probably damaging 1.00
R7470:Ccr7 UTSW 11 99145557 missense possibly damaging 0.80
R7549:Ccr7 UTSW 11 99145901 missense probably damaging 1.00
Z1176:Ccr7 UTSW 11 99144980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCATAGGCAATGTTGAGC -3'
(R):5'- TCATCAGCAAGCTGTCCTG -3'

Sequencing Primer
(F):5'- CATAGGCAATGTTGAGCTGCTTG -3'
(R):5'- CAGCAAGCTGTCCTGTGTGG -3'
Posted On2016-06-09