Incidental Mutation 'IGL03047:Cyp4f17'
ID392242
Institutional Source Beutler Lab
Gene Symbol Cyp4f17
Ensembl Gene ENSMUSG00000091586
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 17
SynonymsEG208285
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #IGL03047 (G1)
Quality Score188
Status Validated
Chromosome17
Chromosomal Location32506462-32528894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32524049 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 232 (I232K)
Ref Sequence ENSEMBL: ENSMUSP00000129514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165999
AA Change: I232K

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129514
Gene: ENSMUSG00000091586
AA Change: I232K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:p450 52 515 3.5e-135 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Ccr7 C T 11: 99,145,334 R254H probably benign Het
Cdk2ap1 G T 5: 124,348,690 A63E possibly damaging Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp2c68 T G 19: 39,734,460 I215L probably benign Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 V938E probably damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Tm9sf4 A G 2: 153,161,406 probably benign Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Cyp4f17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp4f17 APN 17 32524875 nonsense probably null
IGL01767:Cyp4f17 APN 17 32506982 missense probably benign
IGL01867:Cyp4f17 APN 17 32528083 missense probably benign 0.30
IGL02009:Cyp4f17 APN 17 32524880 missense probably damaging 1.00
IGL02423:Cyp4f17 APN 17 32506949 missense possibly damaging 0.93
IGL02503:Cyp4f17 APN 17 32524966 critical splice donor site probably null
IGL02571:Cyp4f17 APN 17 32524904 missense probably benign 0.42
IGL03328:Cyp4f17 APN 17 32520626 missense probably damaging 1.00
PIT4810001:Cyp4f17 UTSW 17 32524600 missense possibly damaging 0.56
R0486:Cyp4f17 UTSW 17 32524823 splice site probably benign
R0606:Cyp4f17 UTSW 17 32527843 missense probably damaging 0.98
R0655:Cyp4f17 UTSW 17 32524897 missense possibly damaging 0.95
R1781:Cyp4f17 UTSW 17 32524019 missense possibly damaging 0.94
R1795:Cyp4f17 UTSW 17 32517969 missense probably benign 0.00
R1833:Cyp4f17 UTSW 17 32524210 missense probably benign 0.01
R2268:Cyp4f17 UTSW 17 32517954 missense probably benign 0.44
R3030:Cyp4f17 UTSW 17 32506976 missense possibly damaging 0.93
R3861:Cyp4f17 UTSW 17 32528104 missense probably damaging 0.97
R5236:Cyp4f17 UTSW 17 32520632 critical splice donor site probably null
R5450:Cyp4f17 UTSW 17 32528886 missense probably benign
R5866:Cyp4f17 UTSW 17 32506913 missense probably benign 0.03
R5886:Cyp4f17 UTSW 17 32524039 missense possibly damaging 0.78
R5965:Cyp4f17 UTSW 17 32524637 missense probably damaging 0.99
R6692:Cyp4f17 UTSW 17 32506976 missense possibly damaging 0.93
R7056:Cyp4f17 UTSW 17 32527872 missense possibly damaging 0.94
R7968:Cyp4f17 UTSW 17 32524142 missense possibly damaging 0.87
R8458:Cyp4f17 UTSW 17 32520576 missense probably damaging 1.00
R8550:Cyp4f17 UTSW 17 32527962 missense probably benign 0.01
R8818:Cyp4f17 UTSW 17 32524094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGCTACTCACGGGAAG -3'
(R):5'- AAGAGCACATCGATGAAGTCC -3'

Sequencing Primer
(F):5'- CTACTCACGGGAAGCAGGAAG -3'
(R):5'- CATCGATGAAGTCCAGGGTTTTAGAC -3'
Posted On2016-06-09