Incidental Mutation 'IGL03047:Cyp2c68'
ID392245
Institutional Source Beutler Lab
Gene Symbol Cyp2c68
Ensembl Gene ENSMUSG00000074882
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms9030012A22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03047 (G1)
Quality Score156
Status Validated
Chromosome19
Chromosomal Location39688834-39741054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39734460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 215 (I215L)
Ref Sequence ENSEMBL: ENSMUSP00000097071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099472]
Predicted Effect probably benign
Transcript: ENSMUST00000099472
AA Change: I215L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882
AA Change: I215L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-150 PFAM
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
4933427D14Rik A G 11: 72,166,726 I749T possibly damaging Het
Adam22 A G 5: 8,082,220 S869P probably damaging Het
Add3 A G 19: 53,242,591 T566A probably benign Het
Asic3 A C 5: 24,413,790 M27L probably benign Het
Atp2c1 T A 9: 105,521,007 probably benign Het
Cabin1 A T 10: 75,700,100 probably benign Het
Ccr7 C T 11: 99,145,334 R254H probably benign Het
Cdk2ap1 G T 5: 124,348,690 A63E possibly damaging Het
Cfap70 T C 14: 20,448,578 T14A possibly damaging Het
Cldn11 T A 3: 31,163,107 F141L probably damaging Het
Comp G T 8: 70,374,909 A107S possibly damaging Het
Cyp2b23 A T 7: 26,681,467 probably benign Het
Cyp4f17 T A 17: 32,524,049 I232K possibly damaging Het
Dram2 T G 3: 106,573,029 F219L probably damaging Het
Fam186a G A 15: 99,945,708 A885V unknown Het
Fbxo42 A G 4: 141,199,542 T378A possibly damaging Het
Frmpd1 T A 4: 45,283,993 V938E probably damaging Het
Gramd1c C A 16: 43,988,247 L489F probably damaging Het
Il17ra T C 6: 120,481,226 I446T probably damaging Het
Il1f9 G A 2: 24,192,707 A165T probably damaging Het
Kcne4 G T 1: 78,817,778 V48F possibly damaging Het
Ly6g6c T A 17: 35,069,349 probably null Het
Mars2 A G 1: 55,238,873 Y545C probably benign Het
Mmp12 T G 9: 7,357,797 probably benign Het
Mthfd1l T A 10: 3,980,409 probably benign Het
Nop14 C T 5: 34,660,014 R11K possibly damaging Het
Npas3 T A 12: 53,831,687 probably benign Het
Odf2 A T 2: 29,920,895 probably benign Het
Olfr1140 A G 2: 87,746,994 Y266C possibly damaging Het
Olfr1389 A G 11: 49,430,967 M164V probably benign Het
Olfr498 T C 7: 108,465,776 S151P probably damaging Het
Olfr750 A G 14: 51,071,156 I79T possibly damaging Het
Otud7b T C 3: 96,150,984 probably benign Het
Papd7 C A 13: 69,502,911 D369Y probably damaging Het
Plcg1 T C 2: 160,754,879 Y747H probably damaging Het
Runx1t1 G A 4: 13,865,882 V357I probably damaging Het
Seh1l C G 18: 67,789,450 T291R probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sulf2 G T 2: 166,080,894 probably null Het
Tex14 C T 11: 87,536,704 S1174F probably damaging Het
Tm9sf4 A G 2: 153,161,406 probably benign Het
Vmn2r7 G A 3: 64,707,218 H392Y possibly damaging Het
Zfhx4 T A 3: 5,243,733 V673D probably damaging Het
Other mutations in Cyp2c68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Cyp2c68 APN 19 39712495 missense probably damaging 0.98
IGL00826:Cyp2c68 APN 19 39739505 missense possibly damaging 0.87
IGL01363:Cyp2c68 APN 19 39703427 missense probably benign 0.01
IGL01892:Cyp2c68 APN 19 39734344 missense probably benign 0.00
IGL02088:Cyp2c68 APN 19 39703521 splice site probably benign
IGL02422:Cyp2c68 APN 19 39734452 missense probably damaging 1.00
R0523:Cyp2c68 UTSW 19 39739429 missense probably benign 0.08
R0729:Cyp2c68 UTSW 19 39739550 splice site probably benign
R0975:Cyp2c68 UTSW 19 39703358 missense possibly damaging 0.85
R1117:Cyp2c68 UTSW 19 39712459 missense probably damaging 1.00
R1355:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1370:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1436:Cyp2c68 UTSW 19 39741040 start codon destroyed probably null 1.00
R1564:Cyp2c68 UTSW 19 39735580 nonsense probably null
R1730:Cyp2c68 UTSW 19 39699275 missense possibly damaging 0.87
R1865:Cyp2c68 UTSW 19 39734289 missense probably benign 0.04
R1905:Cyp2c68 UTSW 19 39735582 missense probably benign 0.01
R1951:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R1952:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R2224:Cyp2c68 UTSW 19 39735582 missense probably benign 0.34
R2230:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2231:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2866:Cyp2c68 UTSW 19 39689145 missense probably damaging 1.00
R3104:Cyp2c68 UTSW 19 39734313 missense probably benign
R4409:Cyp2c68 UTSW 19 39739452 missense probably damaging 0.98
R4575:Cyp2c68 UTSW 19 39734361 missense probably benign 0.21
R4620:Cyp2c68 UTSW 19 39712562 splice site probably null
R4684:Cyp2c68 UTSW 19 39699335 missense possibly damaging 0.48
R5023:Cyp2c68 UTSW 19 39712507 missense probably benign 0.01
R5410:Cyp2c68 UTSW 19 39699284 missense possibly damaging 0.65
R5513:Cyp2c68 UTSW 19 39703406 missense probably damaging 1.00
R5568:Cyp2c68 UTSW 19 39689082 missense probably benign 0.19
R5706:Cyp2c68 UTSW 19 39734318 missense possibly damaging 0.95
R5890:Cyp2c68 UTSW 19 39712492 missense probably damaging 1.00
R5897:Cyp2c68 UTSW 19 39712531 missense probably benign 0.01
R6007:Cyp2c68 UTSW 19 39734336 missense probably damaging 1.00
R6132:Cyp2c68 UTSW 19 39703414 missense possibly damaging 0.90
R6187:Cyp2c68 UTSW 19 39741008 missense probably benign 0.32
R6229:Cyp2c68 UTSW 19 39739178 missense probably benign 0.02
R6341:Cyp2c68 UTSW 19 39712489 missense possibly damaging 0.54
R7209:Cyp2c68 UTSW 19 39689205 missense probably damaging 1.00
R7330:Cyp2c68 UTSW 19 39689190 missense probably damaging 1.00
R7374:Cyp2c68 UTSW 19 39739204 critical splice acceptor site probably null
R7402:Cyp2c68 UTSW 19 39740874 missense probably benign 0.02
R7483:Cyp2c68 UTSW 19 39689137 missense probably benign 0.02
Z1088:Cyp2c68 UTSW 19 39739463 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAACTCTATAGTCCAGGACAAGTC -3'
(R):5'- CACTCAAAAGATATGTGAGTGTGG -3'

Sequencing Primer
(F):5'- CTTTACCTGACGTCTTTGAATTAGG -3'
(R):5'- TTGCAGAAATTTGTTCAACCAATC -3'
Posted On2016-06-09