Incidental Mutation 'IGL02799:Nkain4'
ID392257
Institutional Source Beutler Lab
Gene Symbol Nkain4
Ensembl Gene ENSMUSG00000027574
Gene NameNa+/K+ transporting ATPase interacting 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #IGL02799 (G1)
Quality Score149
Status Validated
Chromosome2
Chromosomal Location180934772-180954699 bp(-) (GRCm38)
Type of Mutationunclassified (1246 bp from exon)
DNA Base Change (assembly) A to T at 180935935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103053] [ENSMUST00000108873] [ENSMUST00000108875] [ENSMUST00000148905] [ENSMUST00000151494]
Predicted Effect probably benign
Transcript: ENSMUST00000103053
SMART Domains Protein: ENSMUSP00000099342
Gene: ENSMUSG00000027574

DomainStartEndE-ValueType
Pfam:NKAIN 1 206 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108873
SMART Domains Protein: ENSMUSP00000104501
Gene: ENSMUSG00000027574

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108875
SMART Domains Protein: ENSMUSP00000104503
Gene: ENSMUSG00000038840

DomainStartEndE-ValueType
BIR 91 162 1.41e-32 SMART
low complexity region 227 238 N/A INTRINSIC
RING 239 272 1.65e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137859
Predicted Effect probably null
Transcript: ENSMUST00000139929
SMART Domains Protein: ENSMUSP00000116965
Gene: ENSMUSG00000027574

DomainStartEndE-ValueType
Pfam:NKAIN 15 144 2.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148905
SMART Domains Protein: ENSMUSP00000119925
Gene: ENSMUSG00000027574

DomainStartEndE-ValueType
Pfam:NKAIN 1 66 1.4e-36 PFAM
Pfam:NKAIN 64 140 8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151494
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN4 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain and interacts with the beta subunit of Na,K-ATPase (ATP1B1; MIM 182330) (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Nkain4
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Nkain4 UTSW 2 180943145 missense probably benign 0.01
R0648:Nkain4 UTSW 2 180943112 missense possibly damaging 0.91
R1619:Nkain4 UTSW 2 180936001 missense probably damaging 0.98
R4472:Nkain4 UTSW 2 180954622 start codon destroyed probably null 0.80
R5666:Nkain4 UTSW 2 180943202 missense probably damaging 0.99
R5670:Nkain4 UTSW 2 180943202 missense probably damaging 0.99
R6191:Nkain4 UTSW 2 180936003 missense probably damaging 1.00
R6191:Nkain4 UTSW 2 180936004 missense probably damaging 1.00
R6713:Nkain4 UTSW 2 180944177 missense probably damaging 1.00
R7228:Nkain4 UTSW 2 180954569 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGCCTGTTGGTATCTC -3'
(R):5'- ATCTGCTACGGGGAATGTTTTC -3'

Sequencing Primer
(F):5'- AGACTCTGCGACCTGGTTATTACAG -3'
(R):5'- AATGTTTTCCATTCTGCCATCTTTTC -3'
Posted On2016-06-09