Incidental Mutation 'IGL02799:Insrr'
ID392258
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Nameinsulin receptor-related receptor
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #IGL02799 (G1)
Quality Score153
Status Validated
Chromosome3
Chromosomal Location87796951-87816101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87813581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1049 (V1049M)
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: V1049M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: V1049M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: V1049M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: V1049M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 intron probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 intron probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 intron probably null
R5685:Insrr UTSW 3 87800496 intron probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAAGGTCAGGGGATTTTAGGTC -3'
(R):5'- ATGTCACTGAGTGCAGGCTG -3'

Sequencing Primer
(F):5'- TTTAGGTCAGGATTAGGATGACAC -3'
(R):5'- GGCTGGTGAAGGACTTCC -3'
Posted On2016-06-09