Incidental Mutation 'IGL02799:Celsr2'
ID 392259
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL02799 (G1)
Quality Score 137
Status Validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108321378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 478 (D478V)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: D478V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: D478V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Meta Mutation Damage Score 0.9634 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,083,234 (GRCm39) N444S possibly damaging Het
Atp2b2 A T 6: 113,739,813 (GRCm39) Y823* probably null Het
Atp2c1 A C 9: 105,290,242 (GRCm39) probably benign Het
Capns1 A T 7: 29,891,644 (GRCm39) D133E probably benign Het
Cast A G 13: 74,884,871 (GRCm39) V361A probably damaging Het
Cd69 G A 6: 129,245,223 (GRCm39) probably benign Het
Cenpf T C 1: 189,391,849 (GRCm39) E661G probably damaging Het
Chrna1 A G 2: 73,404,985 (GRCm39) probably benign Het
Clec5a C A 6: 40,554,983 (GRCm39) V138F probably damaging Het
Ctsj T A 13: 61,151,634 (GRCm39) I95F probably benign Het
Dcaf1 T A 9: 106,735,139 (GRCm39) S696T probably benign Het
Dcp1a T C 14: 30,241,636 (GRCm39) probably null Het
Dnajc14 C T 10: 128,642,725 (GRCm39) P216S possibly damaging Het
Dst T C 1: 34,218,930 (GRCm39) I1790T possibly damaging Het
Ehmt1 A T 2: 24,705,818 (GRCm39) H789Q probably damaging Het
Exoc7 A T 11: 116,192,007 (GRCm39) L188Q probably damaging Het
Faap100 A G 11: 120,261,561 (GRCm39) L823P probably damaging Het
Fdxacb1 T A 9: 50,683,896 (GRCm39) S620T probably benign Het
Fhl2 C T 1: 43,167,562 (GRCm39) R177Q probably benign Het
Gars1 C A 6: 55,040,084 (GRCm39) T337K probably damaging Het
Ggta1 A T 2: 35,312,211 (GRCm39) F56I probably damaging Het
Gm10715 A C 9: 3,038,062 (GRCm39) probably benign Het
Gpr108 T A 17: 57,544,482 (GRCm39) I343F probably damaging Het
Gpr12 T A 5: 146,520,629 (GRCm39) I98F possibly damaging Het
Hk2 A G 6: 82,737,219 (GRCm39) L3P probably damaging Het
Imp4 C A 1: 34,479,258 (GRCm39) probably benign Het
Insrr G A 3: 87,720,888 (GRCm39) V1049M probably damaging Het
Klhl24 T C 16: 19,933,331 (GRCm39) V314A probably damaging Het
Krt32 A T 11: 99,978,733 (GRCm39) V107D possibly damaging Het
Krtap5-1 G A 7: 141,850,242 (GRCm39) Q189* probably null Het
Lrrc9 A G 12: 72,553,178 (GRCm39) E1360G probably damaging Het
Mdc1 G T 17: 36,157,083 (GRCm39) L163F possibly damaging Het
Mroh1 T G 15: 76,276,661 (GRCm39) probably null Het
Myh8 A G 11: 67,192,418 (GRCm39) probably benign Het
Ndufab1 A T 7: 121,692,949 (GRCm39) probably benign Het
Nek3 A G 8: 22,648,735 (GRCm39) probably benign Het
Ngly1 A T 14: 16,260,636 (GRCm38) I107L probably benign Het
Nkain4 A T 2: 180,577,728 (GRCm39) probably null Het
Nsd2 T A 5: 34,022,132 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,801 (GRCm39) I303T probably benign Het
Or5e1 A T 7: 108,354,830 (GRCm39) M256L probably benign Het
Or5t9 A T 2: 86,659,300 (GRCm39) H68L probably damaging Het
Or7e166 T A 9: 19,624,314 (GRCm39) Y64N probably damaging Het
Or8b12 T A 9: 37,657,805 (GRCm39) I125N probably damaging Het
Pcnt G A 10: 76,248,417 (GRCm39) Q901* probably null Het
Pctp C A 11: 89,881,913 (GRCm39) W81C probably damaging Het
Pik3r5 A T 11: 68,386,773 (GRCm39) I801F probably damaging Het
Ptprj A T 2: 90,299,942 (GRCm39) N193K probably benign Het
Rab11fip1 A T 8: 27,642,788 (GRCm39) D670E probably benign Het
Racgap1 T C 15: 99,530,628 (GRCm39) K201E probably benign Het
Ranbp2 T C 10: 58,316,086 (GRCm39) F2269L probably damaging Het
Rint1 C A 5: 24,024,478 (GRCm39) A760D possibly damaging Het
Ryr2 G A 13: 11,680,848 (GRCm39) P3166S probably damaging Het
Snap29 A G 16: 17,240,367 (GRCm39) N158D probably benign Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
St6galnac1 G T 11: 116,657,473 (GRCm39) probably benign Het
Strc G A 2: 121,209,717 (GRCm39) T202I probably damaging Het
Stxbp4 A G 11: 90,385,426 (GRCm39) probably null Het
Syne1 A T 10: 5,309,059 (GRCm39) M650K probably damaging Het
Tbc1d2b C T 9: 90,105,487 (GRCm39) probably benign Het
Tcfl5 A T 2: 180,280,419 (GRCm39) I328N possibly damaging Het
Tenm2 A G 11: 36,164,235 (GRCm39) Y337H probably damaging Het
Tgfbr2 T C 9: 115,939,204 (GRCm39) K233E possibly damaging Het
Tnk2 T C 16: 32,484,699 (GRCm39) probably benign Het
Trbv13-2 A G 6: 41,098,471 (GRCm39) probably benign Het
Tut4 T C 4: 108,370,725 (GRCm39) Y875H probably benign Het
Usp6nl T A 2: 6,432,360 (GRCm39) probably benign Het
Vmn2r62 A G 7: 42,437,396 (GRCm39) S363P possibly damaging Het
Vnn3 T C 10: 23,727,869 (GRCm39) I93T possibly damaging Het
Ylpm1 A G 12: 85,091,258 (GRCm39) D1108G probably damaging Het
Zbtb17 G A 4: 141,190,691 (GRCm39) G170S probably benign Het
Zfyve26 T C 12: 79,320,084 (GRCm39) E1087G probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108,322,675 (GRCm39) missense unknown
R7326:Celsr2 UTSW 3 108,302,311 (GRCm39) missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9209:Celsr2 UTSW 3 108,321,349 (GRCm39) missense probably benign 0.02
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108,322,578 (GRCm39) missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGGGAAAGTCGTGCCCAAC -3'
(R):5'- AGAAGCGTTATGTGGTCCAG -3'

Sequencing Primer
(F):5'- CTATACTCGAGGCGGGCGTTATC -3'
(R):5'- AGTTCTCCGAGTCACCGC -3'
Posted On 2016-06-09