Incidental Mutation 'IGL02799:Rint1'
ID392263
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene NameRAD50 interactor 1
Synonyms2810450M21Rik, 1500019C06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02799 (G1)
Quality Score112
Status Validated
Chromosome5
Chromosomal Location23787711-23820369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23819480 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 760 (A760D)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030852
AA Change: A760D

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: A760D

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115113
AA Change: A702D

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: A702D

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144709
Meta Mutation Damage Score 0.4621 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
breakage UTSW 5 23800722 missense probably damaging 0.99
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1552:Rint1 UTSW 5 23800658 missense probably benign 0.00
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R2920:Rint1 UTSW 5 23805402 missense probably benign 0.00
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4398:Rint1 UTSW 5 23794447 missense possibly damaging 0.55
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7647:Rint1 UTSW 5 23800802 missense probably damaging 1.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACATGTAGAACCAAGTAGTCC -3'
(R):5'- GAGAACTTCAATCCAACTCTTGAC -3'

Sequencing Primer
(F):5'- GTCCATAGATAGTTAAATGGCTGTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2016-06-09