Incidental Mutation 'R0442:Olfr800'
ID39227
Institutional Source Beutler Lab
Gene Symbol Olfr800
Ensembl Gene ENSMUSG00000108114
Gene Nameolfactory receptor 800
SynonymsGA_x6K02T2PULF-11338429-11339364, MOR114-7
MMRRC Submission 038643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0442 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129657694-129662074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129659824 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 6 (I6T)
Ref Sequence ENSEMBL: ENSMUSP00000151047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104903] [ENSMUST00000217094]
Predicted Effect probably benign
Transcript: ENSMUST00000104903
AA Change: I6T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100499
Gene: ENSMUSG00000108114
AA Change: I6T

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 7.3e-43 PFAM
Pfam:7tm_1 38 287 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217094
AA Change: I6T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.4%
  • 20x: 81.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,396,470 N816Y probably damaging Het
Arfgef3 T C 10: 18,677,815 probably benign Het
Cd200 T A 16: 45,397,155 S58C probably damaging Het
Cep128 C T 12: 91,266,771 E508K probably damaging Het
Dnah2 C A 11: 69,448,542 L3046F probably damaging Het
Duox2 T C 2: 122,289,332 N872D probably benign Het
Fam90a1a C T 8: 21,963,058 T143I probably benign Het
Fdft1 T C 14: 63,163,349 T112A probably benign Het
Gimap9 G T 6: 48,678,066 G196* probably null Het
Grhl1 G A 12: 24,612,170 R536Q probably damaging Het
Gtpbp3 T A 8: 71,491,491 V293E probably damaging Het
Hcn3 A T 3: 89,151,540 F251Y probably damaging Het
Hectd4 T A 5: 121,323,982 C971S possibly damaging Het
Helz2 T A 2: 181,232,209 D2164V probably damaging Het
Hif1an T G 19: 44,566,012 L188R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqgap3 C T 3: 88,115,959 P519L probably damaging Het
Jakmip1 T G 5: 37,135,553 probably null Het
Klra1 T C 6: 130,372,872 Y201C probably damaging Het
Minpp1 T C 19: 32,493,948 F299L possibly damaging Het
Myb A G 10: 21,126,196 S749P probably benign Het
Myo3b T C 2: 70,238,961 probably null Het
Naip1 T A 13: 100,444,516 R74S probably benign Het
Nt5m A G 11: 59,874,619 T158A possibly damaging Het
Obscn A T 11: 59,002,174 probably benign Het
Olfr1475 T G 19: 13,480,048 D50A probably damaging Het
Olfr312 T A 11: 58,831,431 Y92* probably null Het
Otogl T A 10: 107,876,855 T543S probably damaging Het
Pds5b T C 5: 150,716,544 probably benign Het
Plekhm1 A G 11: 103,397,174 M49T possibly damaging Het
Rabl6 A T 2: 25,587,522 S305R probably damaging Het
Rad54b G A 4: 11,609,480 probably benign Het
Rad54b C A 4: 11,610,362 R660S probably benign Het
Rexo5 T C 7: 119,843,285 L542P probably damaging Het
Rp1 C T 1: 4,346,747 D1381N probably benign Het
Scnn1a T G 6: 125,339,137 M346R probably damaging Het
Sirpb1c A G 3: 15,802,546 I380T probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sstr3 A T 15: 78,540,397 L50Q probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Sun5 T C 2: 153,870,952 D16G possibly damaging Het
Svil A T 18: 5,046,870 T39S probably damaging Het
Taar1 A G 10: 23,920,482 Y26C possibly damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Use1 T C 8: 71,367,058 probably benign Het
Usp54 T C 14: 20,607,209 Y7C probably damaging Het
Zbtb37 A G 1: 161,032,348 F129S possibly damaging Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp28 T C 7: 6,394,999 L811P probably damaging Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Other mutations in Olfr800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr800 APN 10 129660126 missense probably benign 0.26
IGL01915:Olfr800 APN 10 129660650 missense probably benign 0.05
IGL02458:Olfr800 APN 10 129660606 missense probably benign 0.38
IGL02721:Olfr800 APN 10 129659955 missense probably benign
R0032:Olfr800 UTSW 10 129660400 missense probably benign 0.05
R1564:Olfr800 UTSW 10 129660015 missense probably benign 0.22
R1580:Olfr800 UTSW 10 129660315 missense probably benign 0.10
R1593:Olfr800 UTSW 10 129660225 nonsense probably null
R1911:Olfr800 UTSW 10 129660112 missense probably benign 0.07
R2001:Olfr800 UTSW 10 129660421 missense probably benign 0.02
R2223:Olfr800 UTSW 10 129659809 start codon destroyed probably null 1.00
R3876:Olfr800 UTSW 10 129660274 missense probably benign 0.39
R3884:Olfr800 UTSW 10 129660538 missense probably damaging 1.00
R4366:Olfr800 UTSW 10 129660531 missense probably benign 0.02
R4689:Olfr800 UTSW 10 129660316 missense probably benign 0.01
R4909:Olfr800 UTSW 10 129660720 missense probably benign 0.01
R5638:Olfr800 UTSW 10 129660100 missense possibly damaging 0.80
R5835:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R5838:Olfr800 UTSW 10 129660038 missense probably benign 0.41
R6150:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R6248:Olfr800 UTSW 10 129660663 missense probably benign 0.39
R8094:Olfr800 UTSW 10 129660064 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGCTCTAAGGAGGAAATCAGTACC -3'
(R):5'- TGCAGATGGCTACATATCGGTCATAGG -3'

Sequencing Primer
(F):5'- TAGCAGCCAATTCAAACTGCTTG -3'
(R):5'- TACATATCGGTCATAGGACATGATGG -3'
Posted On2013-05-23