Incidental Mutation 'IGL02799:Olfr874'
ID392279
Institutional Source Beutler Lab
Gene Symbol Olfr874
Ensembl Gene ENSMUSG00000063350
Gene Nameolfactory receptor 874
SynonymsMOR161-2, GA_x6K02T2PVTD-31428850-31429782
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #IGL02799 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37745106-37748594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37746509 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000150088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]
Predicted Effect probably damaging
Transcript: ENSMUST00000115004
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: I125N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.9e-49 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216982
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3531 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Olfr874
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr874 APN 9 37746389 missense possibly damaging 0.89
IGL02349:Olfr874 APN 9 37746206 missense probably benign 0.03
R0498:Olfr874 UTSW 9 37746254 missense probably damaging 1.00
R0690:Olfr874 UTSW 9 37746217 missense probably benign 0.01
R1053:Olfr874 UTSW 9 37746835 missense probably damaging 0.99
R1777:Olfr874 UTSW 9 37746311 missense possibly damaging 0.78
R1862:Olfr874 UTSW 9 37746968 missense probably benign
R1907:Olfr874 UTSW 9 37746433 missense probably benign 0.35
R4524:Olfr874 UTSW 9 37746866 missense possibly damaging 0.50
R4731:Olfr874 UTSW 9 37746535 missense probably benign 0.06
R4746:Olfr874 UTSW 9 37746157 missense probably benign 0.02
R4768:Olfr874 UTSW 9 37746881 missense probably damaging 1.00
R5130:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R5406:Olfr874 UTSW 9 37746647 missense probably benign 0.23
R5546:Olfr874 UTSW 9 37746524 missense probably benign 0.05
R5882:Olfr874 UTSW 9 37746632 missense probably benign 0.02
R5946:Olfr874 UTSW 9 37747034 missense probably damaging 0.99
R6226:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R6705:Olfr874 UTSW 9 37746734 missense possibly damaging 0.94
R6965:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R8008:Olfr874 UTSW 9 37746793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGGCTGAACTCTCACCTTC -3'
(R):5'- GCTATTGCAAGAGAGCTCAAG -3'

Sequencing Primer
(F):5'- GGGCTGAACTCTCACCTTCATACC -3'
(R):5'- CTCAAGAAGGGGAAGAATATCACAC -3'
Posted On2016-06-09