Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL02799:Tgfbr2'

392283

Institutional Source

Beutler Lab

Gene Symbol

Tgfbr2

Ensembl Gene

ENSMUSG00000032440

Gene Name

transforming growth factor, beta receptor II

Synonyms

TbetaR-II, TBR-II, TbetaRII, 1110020H15Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL02799 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116084293-116175360 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116110136 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 233 (K233E)

Ref Sequence

ENSEMBL: ENSMUSP00000062333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]

Predicted Effect

probably benign
Transcript: ENSMUST00000035014
AA Change: K208E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: K208E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	47	165	1.8e-55	PFAM
Pfam:Pkinase	244	538	9.9e-52	PFAM
Pfam:Pkinase_Tyr	244	538	2.9e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061101
AA Change: K233E

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: K233E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	74	184	4.6e-45	PFAM
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:Pkinase	269	563	2.7e-36	PFAM
Pfam:Pkinase_Tyr	269	563	5e-37	PFAM

Meta Mutation Damage Score

0.2870

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add2	A	G	6: 86,106,252	N444S	possibly damaging	Het
Atp2b2	A	T	6: 113,762,852	Y823*	probably null	Het
Atp2c1	A	C	9: 105,413,043		probably benign	Het
Capns1	A	T	7: 30,192,219	D133E	probably benign	Het
Cast	A	G	13: 74,736,752	V361A	probably damaging	Het
Cd69	G	A	6: 129,268,260		probably benign	Het
Celsr2	T	A	3: 108,414,062	D478V	probably damaging	Het
Cenpf	T	C	1: 189,659,652	E661G	probably damaging	Het
Chrna1	A	G	2: 73,574,641		probably benign	Het
Clec5a	C	A	6: 40,578,049	V138F	probably damaging	Het
Ctsj	T	A	13: 61,003,820	I95F	probably benign	Het
Dcaf1	T	A	9: 106,857,940	S696T	probably benign	Het
Dcp1a	T	C	14: 30,519,679		probably null	Het
Dnajc14	C	T	10: 128,806,856	P216S	possibly damaging	Het
Dst	T	C	1: 34,179,849	I1790T	possibly damaging	Het
Ehmt1	A	T	2: 24,815,806	H789Q	probably damaging	Het
Exoc7	A	T	11: 116,301,181	L188Q	probably damaging	Het
Faap100	A	G	11: 120,370,735	L823P	probably damaging	Het
Fdxacb1	T	A	9: 50,772,596	S620T	probably benign	Het
Fhl2	C	T	1: 43,128,402	R177Q	probably benign	Het
Gars	C	A	6: 55,063,099	T337K	probably damaging	Het
Ggta1	A	T	2: 35,422,199	F56I	probably damaging	Het
Gm10715	A	C	9: 3,038,062		probably benign	Het
Gpr108	T	A	17: 57,237,482	I343F	probably damaging	Het
Gpr12	T	A	5: 146,583,819	I98F	possibly damaging	Het
Hk2	A	G	6: 82,760,238	L3P	probably damaging	Het
Imp4	C	A	1: 34,440,177		probably benign	Het
Insrr	G	A	3: 87,813,581	V1049M	probably damaging	Het
Klhl24	T	C	16: 20,114,581	V314A	probably damaging	Het
Krt32	A	T	11: 100,087,907	V107D	possibly damaging	Het
Krtap5-1	G	A	7: 142,296,505	Q189*	probably null	Het
Lrrc9	A	G	12: 72,506,404	E1360G	probably damaging	Het
Mdc1	G	T	17: 35,846,191	L163F	possibly damaging	Het
Mroh1	T	G	15: 76,392,461		probably null	Het
Myh8	A	G	11: 67,301,592		probably benign	Het
Ndufab1	A	T	7: 122,093,726		probably benign	Het
Nek3	A	G	8: 22,158,719		probably benign	Het
Ngly1	A	T	14: 16,260,636	I107L	probably benign	Het
Nkain4	A	T	2: 180,935,935		probably null	Het
Nsd2	T	A	5: 33,864,788		probably benign	Het
Olfr1094	A	T	2: 86,828,956	H68L	probably damaging	Het
Olfr513	A	T	7: 108,755,623	M256L	probably benign	Het
Olfr732	A	G	14: 50,281,344	I303T	probably benign	Het
Olfr857	T	A	9: 19,713,018	Y64N	probably damaging	Het
Olfr874	T	A	9: 37,746,509	I125N	probably damaging	Het
Pcnt	G	A	10: 76,412,583	Q901*	probably null	Het
Pctp	C	A	11: 89,991,087	W81C	probably damaging	Het
Pik3r5	A	T	11: 68,495,947	I801F	probably damaging	Het
Ptprj	A	T	2: 90,469,598	N193K	probably benign	Het
Rab11fip1	A	T	8: 27,152,760	D670E	probably benign	Het
Racgap1	T	C	15: 99,632,747	K201E	probably benign	Het
Ranbp2	T	C	10: 58,480,264	F2269L	probably damaging	Het
Rint1	C	A	5: 23,819,480	A760D	possibly damaging	Het
Ryr2	G	A	13: 11,665,962	P3166S	probably damaging	Het
Snap29	A	G	16: 17,422,503	N158D	probably benign	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
St6galnac1	G	T	11: 116,766,647		probably benign	Het
Strc	G	A	2: 121,379,236	T202I	probably damaging	Het
Stxbp4	A	G	11: 90,494,600		probably null	Het
Syne1	A	T	10: 5,359,059	M650K	probably damaging	Het
Tbc1d2b	C	T	9: 90,223,434		probably benign	Het
Tcfl5	A	T	2: 180,638,626	I328N	possibly damaging	Het
Tenm2	A	G	11: 36,273,408	Y337H	probably damaging	Het
Tnk2	T	C	16: 32,665,881		probably benign	Het
Trbv13-2	A	G	6: 41,121,537		probably benign	Het
Usp6nl	T	A	2: 6,427,549		probably benign	Het
Vmn2r62	A	G	7: 42,787,972	S363P	possibly damaging	Het
Vnn3	T	C	10: 23,851,971	I93T	possibly damaging	Het
Ylpm1	A	G	12: 85,044,484	D1108G	probably damaging	Het
Zbtb17	G	A	4: 141,463,380	G170S	probably benign	Het
Zcchc11	T	C	4: 108,513,528	Y875H	probably benign	Het
Zfyve26	T	C	12: 79,273,310	E1087G	probably benign	Het

Other mutations in Tgfbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tgfbr2	APN	9	116110189	missense	probably damaging	0.99
IGL00484:Tgfbr2	APN	9	116158289	missense	probably benign	0.00
IGL01010:Tgfbr2	APN	9	116129980	missense	possibly damaging	0.80
IGL01656:Tgfbr2	APN	9	116109669	missense	probably damaging	1.00
IGL02496:Tgfbr2	APN	9	116090418	missense	probably benign	0.13
IGL02550:Tgfbr2	APN	9	116110129	missense	probably benign
IGL02563:Tgfbr2	APN	9	116129998	missense	probably benign	0.10
IGL03403:Tgfbr2	APN	9	116110302	missense	probably benign
R0617:Tgfbr2	UTSW	9	116158320	missense	probably benign	0.00
R1483:Tgfbr2	UTSW	9	116109557	missense	probably benign	0.04
R1776:Tgfbr2	UTSW	9	116174967	missense	possibly damaging	0.94
R1777:Tgfbr2	UTSW	9	116109880	missense	probably damaging	0.99
R1831:Tgfbr2	UTSW	9	116090536	missense	possibly damaging	0.74
R2323:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R2378:Tgfbr2	UTSW	9	116129950	missense	probably benign	0.02
R3123:Tgfbr2	UTSW	9	116110069	missense	possibly damaging	0.95
R3418:Tgfbr2	UTSW	9	116129833	missense	probably damaging	1.00
R3605:Tgfbr2	UTSW	9	116109892	missense	probably benign	0.03
R4039:Tgfbr2	UTSW	9	116175037	start codon destroyed	probably null	0.62
R4191:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4193:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4945:Tgfbr2	UTSW	9	116131565	missense	probably benign
R5431:Tgfbr2	UTSW	9	116131601	missense	probably damaging	0.99
R5714:Tgfbr2	UTSW	9	116175024	missense	probably damaging	0.98
R5964:Tgfbr2	UTSW	9	116110255	missense	possibly damaging	0.64
R6180:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R6970:Tgfbr2	UTSW	9	116110051	missense	probably damaging	0.97
R7228:Tgfbr2	UTSW	9	116109943	missense	probably damaging	1.00
R7258:Tgfbr2	UTSW	9	116129830	missense	probably damaging	0.98
R7315:Tgfbr2	UTSW	9	116109738	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TCAGCTTGGCCTTGTAGACCTC -3'
(R):5'- ATGGACTTGCTTCCCGGTAG -3'

Sequencing Primer
(F):5'- CTTGTAGACCTCGGCGAAG -3'
(R):5'- GTGATGCACACCTCCAGAG -3'

Posted On

2016-06-09