Incidental Mutation 'IGL02799:Pik3r5'
ID392290
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #IGL02799 (G1)
Quality Score145
Status Validated
Chromosome11
Chromosomal Location68432121-68497849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68495947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 801 (I801F)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
Predicted Effect probably damaging
Transcript: ENSMUST00000021283
AA Change: I801F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: I801F

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Meta Mutation Damage Score 0.6418 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68496194 missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68494547 missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68496001 missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68486626 splice site probably null
IGL01623:Pik3r5 APN 11 68486626 splice site probably null
IGL01878:Pik3r5 APN 11 68492530 missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68494171 missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68490855 missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68492726 missense probably benign 0.03
palmetto UTSW 11 68494233 missense probably damaging 1.00
Palmito UTSW 11 68492000 missense probably damaging 1.00
palms UTSW 11 68486622 critical splice donor site probably null
piranha UTSW 11 68486581 missense probably damaging 1.00
Serenoa_repens UTSW 11 68475424 nonsense probably null
R0077:Pik3r5 UTSW 11 68486622 critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68492803 missense probably benign
R0105:Pik3r5 UTSW 11 68490511 missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68490480 missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68494224 missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68494177 missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68492492 missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68493577 missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68492917 missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68493261 intron probably benign
R4716:Pik3r5 UTSW 11 68495204 missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68493638 missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68491964 missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68477468 missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68495977 missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68494233 missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68494251 missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68492270 missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68492318 missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68492675 missense probably benign
R6243:Pik3r5 UTSW 11 68492000 missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68492741 missense probably benign
R6420:Pik3r5 UTSW 11 68475424 nonsense probably null
R6505:Pik3r5 UTSW 11 68492789 missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68490617 missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68486581 missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68492943 missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68492590 missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68476351 missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68490498 missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68493657 missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7968:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
Z1177:Pik3r5 UTSW 11 68492896 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCCCTCGAGACTCGGTAAG -3'
(R):5'- TTCACACCTATAGAACAGGGTG -3'

Sequencing Primer
(F):5'- ACAGGGCCTGGCATAGTTCTC -3'
(R):5'- GATGTAAGAAGGTGGCTCTGC -3'
Posted On2016-06-09