Incidental Mutation 'IGL02799:Lrrc9'
ID 392297
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Name leucine rich repeat containing 9
Synonyms 4921529O18Rik, 4930432K16Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # IGL02799 (G1)
Quality Score 82
Status Validated
Chromosome 12
Chromosomal Location 72481391-72561269 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72553178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1360 (E1360G)
Ref Sequence ENSEMBL: ENSMUSP00000124394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162159] [ENSMUST00000220791] [ENSMUST00000221360]
AlphaFold Q8CDN9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably damaging
Transcript: ENSMUST00000162159
AA Change: E1360G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: E1360G

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000220791
AA Change: E274G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000221360
Meta Mutation Damage Score 0.1610 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,083,234 (GRCm39) N444S possibly damaging Het
Atp2b2 A T 6: 113,739,813 (GRCm39) Y823* probably null Het
Atp2c1 A C 9: 105,290,242 (GRCm39) probably benign Het
Capns1 A T 7: 29,891,644 (GRCm39) D133E probably benign Het
Cast A G 13: 74,884,871 (GRCm39) V361A probably damaging Het
Cd69 G A 6: 129,245,223 (GRCm39) probably benign Het
Celsr2 T A 3: 108,321,378 (GRCm39) D478V probably damaging Het
Cenpf T C 1: 189,391,849 (GRCm39) E661G probably damaging Het
Chrna1 A G 2: 73,404,985 (GRCm39) probably benign Het
Clec5a C A 6: 40,554,983 (GRCm39) V138F probably damaging Het
Ctsj T A 13: 61,151,634 (GRCm39) I95F probably benign Het
Dcaf1 T A 9: 106,735,139 (GRCm39) S696T probably benign Het
Dcp1a T C 14: 30,241,636 (GRCm39) probably null Het
Dnajc14 C T 10: 128,642,725 (GRCm39) P216S possibly damaging Het
Dst T C 1: 34,218,930 (GRCm39) I1790T possibly damaging Het
Ehmt1 A T 2: 24,705,818 (GRCm39) H789Q probably damaging Het
Exoc7 A T 11: 116,192,007 (GRCm39) L188Q probably damaging Het
Faap100 A G 11: 120,261,561 (GRCm39) L823P probably damaging Het
Fdxacb1 T A 9: 50,683,896 (GRCm39) S620T probably benign Het
Fhl2 C T 1: 43,167,562 (GRCm39) R177Q probably benign Het
Gars1 C A 6: 55,040,084 (GRCm39) T337K probably damaging Het
Ggta1 A T 2: 35,312,211 (GRCm39) F56I probably damaging Het
Gm10715 A C 9: 3,038,062 (GRCm39) probably benign Het
Gpr108 T A 17: 57,544,482 (GRCm39) I343F probably damaging Het
Gpr12 T A 5: 146,520,629 (GRCm39) I98F possibly damaging Het
Hk2 A G 6: 82,737,219 (GRCm39) L3P probably damaging Het
Imp4 C A 1: 34,479,258 (GRCm39) probably benign Het
Insrr G A 3: 87,720,888 (GRCm39) V1049M probably damaging Het
Klhl24 T C 16: 19,933,331 (GRCm39) V314A probably damaging Het
Krt32 A T 11: 99,978,733 (GRCm39) V107D possibly damaging Het
Krtap5-1 G A 7: 141,850,242 (GRCm39) Q189* probably null Het
Mdc1 G T 17: 36,157,083 (GRCm39) L163F possibly damaging Het
Mroh1 T G 15: 76,276,661 (GRCm39) probably null Het
Myh8 A G 11: 67,192,418 (GRCm39) probably benign Het
Ndufab1 A T 7: 121,692,949 (GRCm39) probably benign Het
Nek3 A G 8: 22,648,735 (GRCm39) probably benign Het
Ngly1 A T 14: 16,260,636 (GRCm38) I107L probably benign Het
Nkain4 A T 2: 180,577,728 (GRCm39) probably null Het
Nsd2 T A 5: 34,022,132 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,801 (GRCm39) I303T probably benign Het
Or5e1 A T 7: 108,354,830 (GRCm39) M256L probably benign Het
Or5t9 A T 2: 86,659,300 (GRCm39) H68L probably damaging Het
Or7e166 T A 9: 19,624,314 (GRCm39) Y64N probably damaging Het
Or8b12 T A 9: 37,657,805 (GRCm39) I125N probably damaging Het
Pcnt G A 10: 76,248,417 (GRCm39) Q901* probably null Het
Pctp C A 11: 89,881,913 (GRCm39) W81C probably damaging Het
Pik3r5 A T 11: 68,386,773 (GRCm39) I801F probably damaging Het
Ptprj A T 2: 90,299,942 (GRCm39) N193K probably benign Het
Rab11fip1 A T 8: 27,642,788 (GRCm39) D670E probably benign Het
Racgap1 T C 15: 99,530,628 (GRCm39) K201E probably benign Het
Ranbp2 T C 10: 58,316,086 (GRCm39) F2269L probably damaging Het
Rint1 C A 5: 24,024,478 (GRCm39) A760D possibly damaging Het
Ryr2 G A 13: 11,680,848 (GRCm39) P3166S probably damaging Het
Snap29 A G 16: 17,240,367 (GRCm39) N158D probably benign Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
St6galnac1 G T 11: 116,657,473 (GRCm39) probably benign Het
Strc G A 2: 121,209,717 (GRCm39) T202I probably damaging Het
Stxbp4 A G 11: 90,385,426 (GRCm39) probably null Het
Syne1 A T 10: 5,309,059 (GRCm39) M650K probably damaging Het
Tbc1d2b C T 9: 90,105,487 (GRCm39) probably benign Het
Tcfl5 A T 2: 180,280,419 (GRCm39) I328N possibly damaging Het
Tenm2 A G 11: 36,164,235 (GRCm39) Y337H probably damaging Het
Tgfbr2 T C 9: 115,939,204 (GRCm39) K233E possibly damaging Het
Tnk2 T C 16: 32,484,699 (GRCm39) probably benign Het
Trbv13-2 A G 6: 41,098,471 (GRCm39) probably benign Het
Tut4 T C 4: 108,370,725 (GRCm39) Y875H probably benign Het
Usp6nl T A 2: 6,432,360 (GRCm39) probably benign Het
Vmn2r62 A G 7: 42,437,396 (GRCm39) S363P possibly damaging Het
Vnn3 T C 10: 23,727,869 (GRCm39) I93T possibly damaging Het
Ylpm1 A G 12: 85,091,258 (GRCm39) D1108G probably damaging Het
Zbtb17 G A 4: 141,190,691 (GRCm39) G170S probably benign Het
Zfyve26 T C 12: 79,320,084 (GRCm39) E1087G probably benign Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72,533,017 (GRCm39) missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72,510,191 (GRCm39) missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72,557,186 (GRCm39) missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72,517,108 (GRCm39) splice site probably benign
IGL02271:Lrrc9 APN 12 72,557,155 (GRCm39) missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72,513,677 (GRCm39) missense probably benign
IGL02795:Lrrc9 APN 12 72,525,542 (GRCm39) missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72,500,923 (GRCm39) missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72,496,542 (GRCm39) missense probably benign
BB006:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
BB016:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
R0172:Lrrc9 UTSW 12 72,510,260 (GRCm39) missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72,502,802 (GRCm39) missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72,525,537 (GRCm39) missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72,529,788 (GRCm39) missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72,533,062 (GRCm39) missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72,557,156 (GRCm39) missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72,543,878 (GRCm39) missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72,547,533 (GRCm39) missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72,547,533 (GRCm39) missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72,507,599 (GRCm39) nonsense probably null
R1564:Lrrc9 UTSW 12 72,533,827 (GRCm39) missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72,542,435 (GRCm39) splice site probably null
R1632:Lrrc9 UTSW 12 72,506,794 (GRCm39) splice site probably null
R1715:Lrrc9 UTSW 12 72,524,073 (GRCm39) missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72,502,891 (GRCm39) missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72,502,772 (GRCm39) nonsense probably null
R1866:Lrrc9 UTSW 12 72,543,912 (GRCm39) missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72,522,938 (GRCm39) critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72,544,635 (GRCm39) missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72,510,244 (GRCm39) missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72,507,580 (GRCm39) nonsense probably null
R3833:Lrrc9 UTSW 12 72,529,765 (GRCm39) missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72,513,740 (GRCm39) missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72,524,160 (GRCm39) missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72,524,160 (GRCm39) missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72,517,038 (GRCm39) missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72,546,453 (GRCm39) missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72,546,466 (GRCm39) missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72,553,099 (GRCm39) missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72,496,163 (GRCm39) missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72,542,368 (GRCm39) missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72,500,862 (GRCm39) missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72,502,827 (GRCm39) missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72,516,005 (GRCm39) missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72,506,627 (GRCm39) missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72,533,797 (GRCm39) missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72,547,703 (GRCm39) missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72,533,169 (GRCm39) splice site probably null
R6672:Lrrc9 UTSW 12 72,520,710 (GRCm39) missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72,553,167 (GRCm39) missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72,497,546 (GRCm39) missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72,510,238 (GRCm39) missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72,513,726 (GRCm39) missense probably benign 0.00
R7338:Lrrc9 UTSW 12 72,510,305 (GRCm39) splice site probably null
R7398:Lrrc9 UTSW 12 72,547,590 (GRCm39) missense probably damaging 0.98
R7477:Lrrc9 UTSW 12 72,550,301 (GRCm39) critical splice donor site probably null
R7501:Lrrc9 UTSW 12 72,496,490 (GRCm39) missense probably damaging 1.00
R7542:Lrrc9 UTSW 12 72,553,094 (GRCm39) missense probably damaging 0.96
R7816:Lrrc9 UTSW 12 72,542,466 (GRCm39) missense probably damaging 1.00
R7870:Lrrc9 UTSW 12 72,532,964 (GRCm39) missense probably damaging 0.99
R7929:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
R8042:Lrrc9 UTSW 12 72,507,680 (GRCm39) missense probably benign 0.02
R8108:Lrrc9 UTSW 12 72,500,833 (GRCm39) missense probably damaging 1.00
R8192:Lrrc9 UTSW 12 72,496,163 (GRCm39) missense probably damaging 1.00
R8244:Lrrc9 UTSW 12 72,546,384 (GRCm39) missense probably benign 0.22
R8333:Lrrc9 UTSW 12 72,528,317 (GRCm39) missense probably benign 0.38
R9288:Lrrc9 UTSW 12 72,522,858 (GRCm39) missense probably benign 0.01
R9324:Lrrc9 UTSW 12 72,496,171 (GRCm39) missense probably damaging 1.00
R9342:Lrrc9 UTSW 12 72,506,767 (GRCm39) missense probably damaging 1.00
R9557:Lrrc9 UTSW 12 72,532,981 (GRCm39) missense probably benign 0.01
R9624:Lrrc9 UTSW 12 72,497,586 (GRCm39) missense probably benign 0.19
R9677:Lrrc9 UTSW 12 72,497,539 (GRCm39) missense probably damaging 1.00
X0025:Lrrc9 UTSW 12 72,543,834 (GRCm39) missense probably damaging 1.00
Z1176:Lrrc9 UTSW 12 72,524,167 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTGGCCATTCCCAAGC -3'
(R):5'- TTCTATAAACATGGCATGTCCCAG -3'

Sequencing Primer
(F):5'- GCCATTCCCAAGCTGCCTTC -3'
(R):5'- TGTCATTTGAAGTACTGAACAGTG -3'
Posted On 2016-06-09