Incidental Mutation 'IGL02799:Ylpm1'
ID392299
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02799 (G1)
Quality Score114
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85044484 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1108 (D1108G)
Ref Sequence ENSEMBL: ENSMUSP00000128962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably damaging
Transcript: ENSMUST00000021670
AA Change: D1814G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: D1814G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101202
AA Change: D1061G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244
AA Change: D1061G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164558
AA Change: D1356G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: D1356G

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168977
AA Change: D1108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244
AA Change: D1108G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169150
Meta Mutation Damage Score 0.3241 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Mroh1 T G 15: 76,392,461 probably null Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
R7736:Ylpm1 UTSW 12 85012983 missense unknown
R7758:Ylpm1 UTSW 12 85015022 missense unknown
R7807:Ylpm1 UTSW 12 85014081 nonsense probably null
R7838:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7846:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
R7921:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7929:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Z1176:Ylpm1 UTSW 12 85030284 missense possibly damaging 0.93
Z1177:Ylpm1 UTSW 12 85057283 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTCAATTCATTAGACCTGATCTG -3'
(R):5'- GGAGCCAGTATTTCTATGTTGC -3'

Sequencing Primer
(F):5'- GTGACTCTAGGAGAACGA -3'
(R):5'- GCCAGTATTTCTATGTTGCAGAAAAC -3'
Posted On2016-06-09