Incidental Mutation 'IGL02799:Mroh1'
ID392306
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #IGL02799 (G1)
Quality Score139
Status Validated
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 76392461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092595] [ENSMUST00000092595] [ENSMUST00000096385] [ENSMUST00000096385] [ENSMUST00000159218] [ENSMUST00000159218] [ENSMUST00000160728] [ENSMUST00000160728] [ENSMUST00000161305] [ENSMUST00000162319] [ENSMUST00000162319]
Predicted Effect probably null
Transcript: ENSMUST00000092595
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092595
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159218
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159218
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160728
SMART Domains Protein: ENSMUSP00000124321
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 79 3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160728
SMART Domains Protein: ENSMUSP00000124321
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 79 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably null
Transcript: ENSMUST00000161305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162319
SMART Domains Protein: ENSMUSP00000124353
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 267 9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162319
SMART Domains Protein: ENSMUSP00000124353
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 267 9e-6 SMART
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A G 6: 86,106,252 N444S possibly damaging Het
Atp2b2 A T 6: 113,762,852 Y823* probably null Het
Atp2c1 A C 9: 105,413,043 probably benign Het
Capns1 A T 7: 30,192,219 D133E probably benign Het
Cast A G 13: 74,736,752 V361A probably damaging Het
Cd69 G A 6: 129,268,260 probably benign Het
Celsr2 T A 3: 108,414,062 D478V probably damaging Het
Cenpf T C 1: 189,659,652 E661G probably damaging Het
Chrna1 A G 2: 73,574,641 probably benign Het
Clec5a C A 6: 40,578,049 V138F probably damaging Het
Ctsj T A 13: 61,003,820 I95F probably benign Het
Dcaf1 T A 9: 106,857,940 S696T probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnajc14 C T 10: 128,806,856 P216S possibly damaging Het
Dst T C 1: 34,179,849 I1790T possibly damaging Het
Ehmt1 A T 2: 24,815,806 H789Q probably damaging Het
Exoc7 A T 11: 116,301,181 L188Q probably damaging Het
Faap100 A G 11: 120,370,735 L823P probably damaging Het
Fdxacb1 T A 9: 50,772,596 S620T probably benign Het
Fhl2 C T 1: 43,128,402 R177Q probably benign Het
Gars C A 6: 55,063,099 T337K probably damaging Het
Ggta1 A T 2: 35,422,199 F56I probably damaging Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gpr108 T A 17: 57,237,482 I343F probably damaging Het
Gpr12 T A 5: 146,583,819 I98F possibly damaging Het
Hk2 A G 6: 82,760,238 L3P probably damaging Het
Imp4 C A 1: 34,440,177 probably benign Het
Insrr G A 3: 87,813,581 V1049M probably damaging Het
Klhl24 T C 16: 20,114,581 V314A probably damaging Het
Krt32 A T 11: 100,087,907 V107D possibly damaging Het
Krtap5-1 G A 7: 142,296,505 Q189* probably null Het
Lrrc9 A G 12: 72,506,404 E1360G probably damaging Het
Mdc1 G T 17: 35,846,191 L163F possibly damaging Het
Myh8 A G 11: 67,301,592 probably benign Het
Ndufab1 A T 7: 122,093,726 probably benign Het
Nek3 A G 8: 22,158,719 probably benign Het
Ngly1 A T 14: 16,260,636 I107L probably benign Het
Nkain4 A T 2: 180,935,935 probably null Het
Nsd2 T A 5: 33,864,788 probably benign Het
Olfr1094 A T 2: 86,828,956 H68L probably damaging Het
Olfr513 A T 7: 108,755,623 M256L probably benign Het
Olfr732 A G 14: 50,281,344 I303T probably benign Het
Olfr857 T A 9: 19,713,018 Y64N probably damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcnt G A 10: 76,412,583 Q901* probably null Het
Pctp C A 11: 89,991,087 W81C probably damaging Het
Pik3r5 A T 11: 68,495,947 I801F probably damaging Het
Ptprj A T 2: 90,469,598 N193K probably benign Het
Rab11fip1 A T 8: 27,152,760 D670E probably benign Het
Racgap1 T C 15: 99,632,747 K201E probably benign Het
Ranbp2 T C 10: 58,480,264 F2269L probably damaging Het
Rint1 C A 5: 23,819,480 A760D possibly damaging Het
Ryr2 G A 13: 11,665,962 P3166S probably damaging Het
Snap29 A G 16: 17,422,503 N158D probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
St6galnac1 G T 11: 116,766,647 probably benign Het
Strc G A 2: 121,379,236 T202I probably damaging Het
Stxbp4 A G 11: 90,494,600 probably null Het
Syne1 A T 10: 5,359,059 M650K probably damaging Het
Tbc1d2b C T 9: 90,223,434 probably benign Het
Tcfl5 A T 2: 180,638,626 I328N possibly damaging Het
Tenm2 A G 11: 36,273,408 Y337H probably damaging Het
Tgfbr2 T C 9: 116,110,136 K233E possibly damaging Het
Tnk2 T C 16: 32,665,881 probably benign Het
Trbv13-2 A G 6: 41,121,537 probably benign Het
Usp6nl T A 2: 6,427,549 probably benign Het
Vmn2r62 A G 7: 42,787,972 S363P possibly damaging Het
Vnn3 T C 10: 23,851,971 I93T possibly damaging Het
Ylpm1 A G 12: 85,044,484 D1108G probably damaging Het
Zbtb17 G A 4: 141,463,380 G170S probably benign Het
Zcchc11 T C 4: 108,513,528 Y875H probably benign Het
Zfyve26 T C 12: 79,273,310 E1087G probably benign Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0180:Mroh1 UTSW 15 76428250 missense probably damaging 0.99
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0835:Mroh1 UTSW 15 76451883 missense probably damaging 0.96
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R2415:Mroh1 UTSW 15 76421211 missense probably damaging 0.99
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5574:Mroh1 UTSW 15 76433931 missense probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
R7334:Mroh1 UTSW 15 76427638 missense probably benign 0.00
R7337:Mroh1 UTSW 15 76451476 missense probably benign 0.00
R7352:Mroh1 UTSW 15 76451474 missense probably benign 0.06
R7446:Mroh1 UTSW 15 76452272 missense possibly damaging 0.93
R7453:Mroh1 UTSW 15 76433545 missense probably damaging 1.00
R7669:Mroh1 UTSW 15 76451848 missense possibly damaging 0.88
R7753:Mroh1 UTSW 15 76433275 missense possibly damaging 0.62
R7860:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R7943:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R8140:Mroh1 UTSW 15 76433873 missense probably benign 0.00
Z1177:Mroh1 UTSW 15 76423761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCAGCCATGATAGAG -3'
(R):5'- CGCACCCTCAAGTCATCATG -3'

Sequencing Primer
(F):5'- GCCATGATAGAGATCTTCCCTAGG -3'
(R):5'- GTCATCATGAGCATACAGAACCTG -3'
Posted On2016-06-09