Incidental Mutation 'R4680:Crybg2'
ID392332
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R4680 (G1)
Quality Score201
Status Validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTCCAGAGCCATGGACCCATCTTTTCCA to CTTCCA at 134072718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000137053] [ENSMUST00000219402] [ENSMUST00000227683]
Predicted Effect probably null
Transcript: ENSMUST00000121391
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137053
Predicted Effect probably benign
Transcript: ENSMUST00000219402
Predicted Effect probably null
Transcript: ENSMUST00000227683
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4931414P19Rik T C 14: 54,585,076 Y368C probably damaging Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Nid1 G A 13: 13,472,852 C401Y probably damaging Het
Obox1 A T 7: 15,556,164 N144I probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr1099 T C 2: 86,959,321 I46V possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Uqcrc1 G A 9: 108,947,861 R77H probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0638:Crybg2 UTSW 4 134074454 missense probably damaging 1.00
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2321:Crybg2 UTSW 4 134074511 missense probably benign 0.38
R2392:Crybg2 UTSW 4 134072614 missense probably benign 0.01
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R2940:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5079:Crybg2 UTSW 4 134074253 missense possibly damaging 0.83
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 splice site probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
R7043:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R7133:Crybg2 UTSW 4 134065443 missense probably benign 0.09
R7166:Crybg2 UTSW 4 134060882 missense probably damaging 0.96
R7412:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R7711:Crybg2 UTSW 4 134065533 missense probably benign 0.00
R7745:Crybg2 UTSW 4 134088845 missense possibly damaging 0.92
R7782:Crybg2 UTSW 4 134073826 missense probably benign 0.00
R7871:Crybg2 UTSW 4 134087599 missense probably damaging 1.00
R7943:Crybg2 UTSW 4 134072984 missense probably damaging 0.97
R8008:Crybg2 UTSW 4 134091104 missense probably damaging 1.00
R8017:Crybg2 UTSW 4 134073173 missense possibly damaging 0.95
R8391:Crybg2 UTSW 4 134075724 missense probably damaging 0.97
R8510:Crybg2 UTSW 4 134073359 missense probably benign
R8535:Crybg2 UTSW 4 134081203 missense probably damaging 1.00
R8695:Crybg2 UTSW 4 134065455 missense possibly damaging 0.55
R8789:Crybg2 UTSW 4 134074243 missense probably benign 0.00
R8870:Crybg2 UTSW 4 134091214 missense possibly damaging 0.88
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Z1176:Crybg2 UTSW 4 134082660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAGACACCGTTTTCAC -3'
(R):5'- TCCTCACGATTCCTGGAACC -3'

Sequencing Primer
(F):5'- TCACAAAGTGTCCCTGGTGTCAG -3'
(R):5'- ATGCGGACTTGGCTCAC -3'
Posted On2016-06-15