Incidental Mutation 'R4441:Mcm5'
ID392334
Institutional Source Beutler Lab
Gene Symbol Mcm5
Ensembl Gene ENSMUSG00000005410
Gene Nameminichromosome maintenance complex component 5
SynonymsCdc46, mCD46, Mcmd5
MMRRC Submission 041706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4441 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75109569-75128439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75112544 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 142 (S142P)
Ref Sequence ENSEMBL: ENSMUSP00000148525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164309] [ENSMUST00000212426] [ENSMUST00000212811]
Predicted Effect probably benign
Transcript: ENSMUST00000164309
AA Change: S142P

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126135
Gene: ENSMUSG00000005410
AA Change: S142P

DomainStartEndE-ValueType
MCM 133 649 N/A SMART
Blast:MCM 693 734 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000212426
AA Change: S142P

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212811
AA Change: S142P

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.3553 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the oligameric minichromosome maintenance protein complex. During DNA replication, the complex loads onto chromatin in early G1 and is converted into an active replicative helicase during S phase. It functions to limit DNA synthesis to once per cell cycle. During embryogenesis, the encoded protein is negatively regulated through expression of paired box protein Pax 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,801 R1238S probably benign Het
Ankmy1 A T 1: 92,888,661 Y244N possibly damaging Het
Asxl3 C T 18: 22,524,233 P1767S probably damaging Het
C1qtnf7 A T 5: 43,609,270 K70N possibly damaging Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fam92a A G 4: 12,157,733 M261T probably damaging Het
Garem1 T C 18: 21,168,750 T127A possibly damaging Het
Gls A T 1: 52,196,163 probably null Het
Gm12790 A C 4: 101,968,140 S26A probably damaging Het
Gm136 T C 4: 34,755,911 D34G probably benign Het
Gmds A G 13: 31,940,478 probably null Het
Hdac9 G T 12: 34,389,376 H401N probably damaging Het
Hmcn1 T C 1: 150,657,459 I3026V probably null Het
Igkv6-20 A T 6: 70,336,117 M24K probably damaging Het
Ilf2 T C 3: 90,487,462 L339P probably benign Het
Insr T A 8: 3,194,902 K501N probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt9 A G 14: 56,027,552 V164A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nfia T C 4: 97,772,913 probably null Het
Nipbl G C 15: 8,366,658 Q144E probably damaging Het
Olfr1346 T C 7: 6,474,925 S272P probably benign Het
Olfr578 A T 7: 102,984,309 V285E possibly damaging Het
Olfr638 T G 7: 104,004,072 F266V probably damaging Het
Pcdhgb8 A G 18: 37,763,061 I395V possibly damaging Het
Plcz1 T A 6: 139,990,687 L605F probably benign Het
Prph G A 15: 99,057,124 S325N probably damaging Het
Ptpn23 A G 9: 110,392,725 M131T probably benign Het
Rab3ip T G 10: 116,915,932 D278A probably benign Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rbm5 A G 9: 107,749,688 probably benign Het
Rc3h2 A G 2: 37,414,514 probably null Het
Tbxa2r T C 10: 81,333,091 S205P probably damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tex45 C T 8: 3,476,105 S86L probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnik A G 3: 28,564,097 I266V possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 A G 7: 64,201,918 D12G probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr7 T A 18: 63,755,210 Y585N probably damaging Het
Zgrf1 T A 3: 127,586,137 N223K possibly damaging Het
Other mutations in Mcm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mcm5 APN 8 75124945 critical splice donor site probably null
IGL00954:Mcm5 APN 8 75110112 missense possibly damaging 0.78
IGL02534:Mcm5 APN 8 75114233 missense probably damaging 1.00
IGL03074:Mcm5 APN 8 75119301 missense possibly damaging 0.94
IGL03176:Mcm5 APN 8 75109853 missense possibly damaging 0.95
IGL03240:Mcm5 APN 8 75115902 missense probably damaging 1.00
PIT4142001:Mcm5 UTSW 8 75127236 missense probably benign
R0133:Mcm5 UTSW 8 75120911 missense probably damaging 1.00
R0138:Mcm5 UTSW 8 75120880 missense probably damaging 1.00
R0226:Mcm5 UTSW 8 75126252 missense possibly damaging 0.90
R0733:Mcm5 UTSW 8 75127248 missense probably benign 0.08
R1217:Mcm5 UTSW 8 75126291 missense probably benign 0.01
R1601:Mcm5 UTSW 8 75119354 missense possibly damaging 0.87
R1834:Mcm5 UTSW 8 75119273 missense possibly damaging 0.64
R1958:Mcm5 UTSW 8 75121629 missense probably benign 0.34
R3410:Mcm5 UTSW 8 75121644 missense possibly damaging 0.88
R4133:Mcm5 UTSW 8 75115854 missense probably damaging 1.00
R5395:Mcm5 UTSW 8 75123026 missense probably benign
R5710:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R5714:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R6075:Mcm5 UTSW 8 75114197 missense probably damaging 1.00
R6093:Mcm5 UTSW 8 75109746 missense probably benign 0.06
R6477:Mcm5 UTSW 8 75112602 missense probably benign 0.36
R6848:Mcm5 UTSW 8 75127290 missense possibly damaging 0.88
R7098:Mcm5 UTSW 8 75120901 missense probably damaging 1.00
R7208:Mcm5 UTSW 8 75121716 critical splice donor site probably null
R7278:Mcm5 UTSW 8 75124859 missense probably benign 0.40
R7552:Mcm5 UTSW 8 75121592 missense probably damaging 0.99
R7701:Mcm5 UTSW 8 75123923 missense probably benign 0.00
Z1177:Mcm5 UTSW 8 75121672 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTCTGCAAGGCCCTTGAAAAG -3'
(R):5'- TTGGCTACACACTCACATATTGC -3'

Sequencing Primer
(F):5'- GTGTATGAGGCTCCTGAACC -3'
(R):5'- ACTCACATATTGCACTTCCTGGG -3'
Posted On2016-06-15