Incidental Mutation 'R5101:Clec4d'
ID392355
Institutional Source Beutler Lab
Gene Symbol Clec4d
Ensembl Gene ENSMUSG00000030144
Gene NameC-type lectin domain family 4, member d
SynonymsClecsf8, mcl, Mpcl, mMCL
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123262111-123275265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123267112 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000032240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032240] [ENSMUST00000204826]
Predicted Effect probably damaging
Transcript: ENSMUST00000032240
AA Change: Y60C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032240
Gene: ENSMUSG00000030144
AA Change: Y60C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 83 207 1.59e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203421
Predicted Effect probably damaging
Transcript: ENSMUST00000204826
AA Change: Y60C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145134
Gene: ENSMUSG00000030144
AA Change: Y60C

DomainStartEndE-ValueType
Blast:CLECT 28 77 1e-8 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to trehalose-6,60'-dimycolate treatment. Mice homozygous for a different knock-out allele exhibit increased susceptibility to pneumonia infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Clec4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Clec4d APN 6 123274773 missense probably damaging 1.00
R0111:Clec4d UTSW 6 123268047 nonsense probably null
R0157:Clec4d UTSW 6 123267136 missense probably benign 0.00
R1756:Clec4d UTSW 6 123267109 missense probably damaging 0.99
R1928:Clec4d UTSW 6 123267161 splice site probably null
R1964:Clec4d UTSW 6 123262360 missense probably benign 0.05
R2208:Clec4d UTSW 6 123265355 missense probably damaging 0.98
R2443:Clec4d UTSW 6 123268117 missense probably benign 0.32
R4740:Clec4d UTSW 6 123268113 missense probably damaging 1.00
R5692:Clec4d UTSW 6 123268145 critical splice donor site probably null
R5785:Clec4d UTSW 6 123274770 missense probably benign 0.09
R5903:Clec4d UTSW 6 123267061 missense probably damaging 0.98
R6005:Clec4d UTSW 6 123267159 missense probably damaging 0.99
R6209:Clec4d UTSW 6 123270529 intron probably null
R7760:Clec4d UTSW 6 123270341 missense probably benign 0.01
R7867:Clec4d UTSW 6 123267164 critical splice donor site probably null
R7950:Clec4d UTSW 6 123267164 critical splice donor site probably null
Z1176:Clec4d UTSW 6 123274686 missense probably benign 0.01
Z1177:Clec4d UTSW 6 123268074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGATCATGAAATGGCATAGG -3'
(R):5'- TCACAACATAGCTGCATCAAGG -3'

Sequencing Primer
(F):5'- TCATGAAATGGCATAGGAAAGAAAG -3'
(R):5'- GCCTAGCATGTACAAGTCCTGTG -3'
Posted On2016-06-15