Incidental Mutation 'R5101:Olfr613'
ID392357
Institutional Source Beutler Lab
Gene Symbol Olfr613
Ensembl Gene ENSMUSG00000078624
Gene Nameolfactory receptor 613
SynonymsMOR20-1, Olfr614, GA_x6K02T2PBJ9-6271959-6272393, GA_x6K02T2PBJ9-6275524-6276477, MOR20-1
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103548074-103555506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103551943 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 53 (E53K)
Ref Sequence ENSEMBL: ENSMUSP00000149332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106888] [ENSMUST00000214173] [ENSMUST00000214345] [ENSMUST00000215673]
Predicted Effect probably damaging
Transcript: ENSMUST00000106888
AA Change: E53K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102501
Gene: ENSMUSG00000078624
AA Change: E53K

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 1.1e-99 PFAM
Pfam:7tm_1 42 293 5.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214173
AA Change: E53K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Olfr613
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr613 APN 7 103551857 missense probably damaging 0.99
IGL03009:Olfr613 APN 7 103552527 nonsense probably null
R0047:Olfr613 UTSW 7 103552322 missense probably damaging 1.00
R0047:Olfr613 UTSW 7 103552322 missense probably damaging 1.00
R1559:Olfr613 UTSW 7 103552165 missense possibly damaging 0.82
R2247:Olfr613 UTSW 7 103551890 unclassified probably null
R4622:Olfr613 UTSW 7 103552154 missense probably benign 0.00
R4674:Olfr613 UTSW 7 103551976 missense probably damaging 1.00
R4675:Olfr613 UTSW 7 103551976 missense probably damaging 1.00
R6396:Olfr613 UTSW 7 103552681 nonsense probably null
R6860:Olfr613 UTSW 7 103551868 missense probably benign
R7310:Olfr613 UTSW 7 103552685 missense probably damaging 1.00
R7318:Olfr613 UTSW 7 103552091 missense probably damaging 0.98
R7593:Olfr613 UTSW 7 103551749 unclassified probably benign
R8046:Olfr613 UTSW 7 103552377 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTGGACTGCAGTTCTACC -3'
(R):5'- CCAAGCGGTCAAAAGCCATG -3'

Sequencing Primer
(F):5'- ACCTCCAACTCATCATGTCAGATGTG -3'
(R):5'- CCTGACTCTACAGAGGACAGTGTG -3'
Posted On2016-06-15