Incidental Mutation 'R5101:Gp1ba'
ID392370
Institutional Source Beutler Lab
Gene Symbol Gp1ba
Ensembl Gene ENSMUSG00000050675
Gene Nameglycoprotein 1b, alpha polypeptide
SynonymsGP Ib-alpha, GPIb-alpha, GPIba
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70639122-70642036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70641399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 664 (V664M)
Ref Sequence ENSEMBL: ENSMUSP00000104191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055184
AA Change: V664M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675
AA Change: V664M

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
AA Change: V664M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675
AA Change: V664M

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit prolonged bleeding times and reduced numbers of enlarged platelets. Heterozygotes have intermediate numbers of platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Gp1ba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gp1ba APN 11 70640652 unclassified probably benign
IGL00715:Gp1ba APN 11 70639918 unclassified probably benign
R0126:Gp1ba UTSW 11 70641033 unclassified probably benign
R0329:Gp1ba UTSW 11 70640409 unclassified probably benign
R0360:Gp1ba UTSW 11 70640458 unclassified probably benign
R0364:Gp1ba UTSW 11 70640458 unclassified probably benign
R0561:Gp1ba UTSW 11 70639590 unclassified probably benign
R0693:Gp1ba UTSW 11 70640458 unclassified probably benign
R0715:Gp1ba UTSW 11 70640788 unclassified probably benign
R0762:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R0766:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1178:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1181:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1448:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1926:Gp1ba UTSW 11 70640889 unclassified probably benign
R2317:Gp1ba UTSW 11 70640647 unclassified probably benign
R6243:Gp1ba UTSW 11 70640137 unclassified probably benign
R7020:Gp1ba UTSW 11 70640313 unclassified probably benign
R7340:Gp1ba UTSW 11 70640293 missense unknown
R7571:Gp1ba UTSW 11 70640094 missense unknown
X0025:Gp1ba UTSW 11 70640902 unclassified probably benign
Z1177:Gp1ba UTSW 11 70639407 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATCTCCCAGAGGTAGCTCTAG -3'
(R):5'- TGTGCCCAATAGGTCCTGAC -3'

Sequencing Primer
(F):5'- TCTCCCAGAGGTAGCTCTAGTAAGC -3'
(R):5'- TCCTGACCACGACCCTG -3'
Posted On2016-06-15