Incidental Mutation 'R5101:Ago2'
ID392381
Institutional Source Beutler Lab
Gene Symbol Ago2
Ensembl Gene ENSMUSG00000036698
Gene Nameargonaute RISC catalytic subunit 2
Synonyms2310051F07Rik, argonaute 2, Eif2c2, 1110029L17Rik
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5101 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73095844-73184935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73119490 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 533 (V533A)
Ref Sequence ENSEMBL: ENSMUSP00000042207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044113]
Predicted Effect probably damaging
Transcript: ENSMUST00000044113
AA Change: V533A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042207
Gene: ENSMUSG00000036698
AA Change: V533A

DomainStartEndE-ValueType
Pfam:ArgoN 29 167 1.7e-29 PFAM
DUF1785 176 228 2.98e-24 SMART
PAZ 236 371 3.11e-4 SMART
Pfam:ArgoL2 376 421 8.7e-16 PFAM
Pfam:ArgoMid 430 512 2.9e-35 PFAM
Piwi 518 819 1.36e-135 SMART
Meta Mutation Damage Score 0.8956 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality with neural tube defects, abnormal forebrain patterning, enlarged hearts, pericardial swelling, delayed development, and defects in the yolk sac and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Uba1y T G Y: 821,447 probably null Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Ago2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ago2 APN 15 73126453 missense probably benign 0.00
IGL01642:Ago2 APN 15 73123390 missense probably benign 0.00
IGL02017:Ago2 APN 15 73126517 missense probably benign 0.15
IGL02246:Ago2 APN 15 73108418 missense probably damaging 1.00
IGL02434:Ago2 APN 15 73121081 missense probably damaging 1.00
IGL02674:Ago2 APN 15 73111794 missense probably damaging 1.00
IGL02686:Ago2 APN 15 73113742 missense possibly damaging 0.95
IGL02716:Ago2 APN 15 73111727 missense possibly damaging 0.94
IGL02751:Ago2 APN 15 73130897 missense possibly damaging 0.76
IGL02973:Ago2 APN 15 73123465 splice site probably benign
IGL03188:Ago2 APN 15 73123333 missense probably benign
PIT4791001:Ago2 UTSW 15 73121240 missense possibly damaging 0.72
R0316:Ago2 UTSW 15 73130876 missense probably damaging 0.99
R1382:Ago2 UTSW 15 73127040 missense probably benign 0.35
R1509:Ago2 UTSW 15 73116364 missense probably damaging 1.00
R1802:Ago2 UTSW 15 73121180 missense probably damaging 1.00
R1848:Ago2 UTSW 15 73123965 missense probably benign 0.02
R1930:Ago2 UTSW 15 73119355 missense probably damaging 0.97
R2195:Ago2 UTSW 15 73119469 missense probably benign 0.15
R2219:Ago2 UTSW 15 73146411 missense probably benign
R2350:Ago2 UTSW 15 73119461 missense probably benign 0.01
R2517:Ago2 UTSW 15 73124242 missense possibly damaging 0.76
R3727:Ago2 UTSW 15 73113857 missense probably damaging 1.00
R4614:Ago2 UTSW 15 73130967 missense probably damaging 0.98
R4667:Ago2 UTSW 15 73146416 missense probably damaging 1.00
R5175:Ago2 UTSW 15 73124218 missense possibly damaging 0.57
R5751:Ago2 UTSW 15 73128323 critical splice donor site probably null
R5815:Ago2 UTSW 15 73107366 critical splice acceptor site probably null
R6166:Ago2 UTSW 15 73124240 missense probably benign 0.00
R6378:Ago2 UTSW 15 73123925 missense probably benign
R6572:Ago2 UTSW 15 73126977 missense probably benign 0.14
R6922:Ago2 UTSW 15 73113752 missense probably benign 0.39
R7068:Ago2 UTSW 15 73146450 missense probably damaging 1.00
R7447:Ago2 UTSW 15 73138032 missense probably benign 0.35
R7449:Ago2 UTSW 15 73146499 missense probably damaging 1.00
X0012:Ago2 UTSW 15 73106952 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTAAGCCAGCTGGTGTATGC -3'
(R):5'- TGAGATGTGCTTCCCGGTTC -3'

Sequencing Primer
(F):5'- CCAGCTGGTGTATGCATGGG -3'
(R):5'- TGCCTGGCAGTGCTAAAG -3'
Posted On2016-06-15