Incidental Mutation 'R5101:Uba1y'
ID392388
Institutional Source Beutler Lab
Gene Symbol Uba1y
Ensembl Gene ENSMUSG00000069053
Gene Nameubiquitin-activating enzyme, Chr Y
SynonymsA1s9Y-1, Ube1y-1, Sby, Ube-2, Ube1y1
MMRRC Submission 042852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R5101 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location818649-844224 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 821447 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115894] [ENSMUST00000115894] [ENSMUST00000115894] [ENSMUST00000190013] [ENSMUST00000190013] [ENSMUST00000190013]
Predicted Effect probably null
Transcript: ENSMUST00000115894
SMART Domains Protein: ENSMUSP00000111560
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 54 448 2.5e-44 PFAM
Pfam:E1_FCCH 226 296 1.1e-34 PFAM
Pfam:E1_4HB 297 365 3.5e-29 PFAM
Pfam:UBA_e1_thiolCys 637 884 9.1e-95 PFAM
low complexity region 890 901 N/A INTRINSIC
UBA_e1_C 922 1053 1.72e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115894
SMART Domains Protein: ENSMUSP00000111560
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 54 448 2.5e-44 PFAM
Pfam:E1_FCCH 226 296 1.1e-34 PFAM
Pfam:E1_4HB 297 365 3.5e-29 PFAM
Pfam:UBA_e1_thiolCys 637 884 9.1e-95 PFAM
low complexity region 890 901 N/A INTRINSIC
UBA_e1_C 922 1053 1.72e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115894
SMART Domains Protein: ENSMUSP00000111560
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 54 448 2.5e-44 PFAM
Pfam:E1_FCCH 226 296 1.1e-34 PFAM
Pfam:E1_4HB 297 365 3.5e-29 PFAM
Pfam:UBA_e1_thiolCys 637 884 9.1e-95 PFAM
low complexity region 890 901 N/A INTRINSIC
UBA_e1_C 922 1053 1.72e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190013
SMART Domains Protein: ENSMUSP00000140543
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 70 201 3.2e-18 PFAM
Pfam:ThiF 466 610 2.9e-36 PFAM
Pfam:UBA_e1_thiolCys 612 656 7.7e-25 PFAM
Pfam:UBACT 752 818 6.3e-13 PFAM
Pfam:UBACT 848 916 2.1e-30 PFAM
UBA_e1_C 922 1053 1.72e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190013
SMART Domains Protein: ENSMUSP00000140543
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 70 201 3.2e-18 PFAM
Pfam:ThiF 466 610 2.9e-36 PFAM
Pfam:UBA_e1_thiolCys 612 656 7.7e-25 PFAM
Pfam:UBACT 752 818 6.3e-13 PFAM
Pfam:UBACT 848 916 2.1e-30 PFAM
UBA_e1_C 922 1053 1.72e-73 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190013
SMART Domains Protein: ENSMUSP00000140543
Gene: ENSMUSG00000069053

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:ThiF 70 201 3.2e-18 PFAM
Pfam:ThiF 466 610 2.9e-36 PFAM
Pfam:UBA_e1_thiolCys 612 656 7.7e-25 PFAM
Pfam:UBACT 752 818 6.3e-13 PFAM
Pfam:UBACT 848 916 2.1e-30 PFAM
UBA_e1_C 922 1053 1.72e-73 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,336 E921G possibly damaging Het
Adam17 T C 12: 21,373,405 T10A possibly damaging Het
Adgrg3 T C 8: 95,036,935 F288S probably benign Het
Ago2 A G 15: 73,119,490 V533A probably damaging Het
Akap9 T G 5: 4,001,748 V1505G probably damaging Het
Apob T C 12: 8,011,934 I3439T probably benign Het
C1qtnf7 T A 5: 43,615,972 Y204* probably null Het
Cdc42bpb T C 12: 111,299,115 E1461G probably damaging Het
Cdh3 C T 8: 106,541,392 A353V possibly damaging Het
Clec4d A G 6: 123,267,112 Y60C probably damaging Het
Cmya5 T A 13: 93,091,603 T2326S possibly damaging Het
Cnot1 G A 8: 95,760,187 L631F possibly damaging Het
Cntnap5a C T 1: 116,442,296 T881I probably benign Het
Col6a1 T A 10: 76,709,906 T911S unknown Het
Ctsw A G 19: 5,465,675 V287A probably benign Het
Cyp2c23 T C 19: 44,029,183 E2G unknown Het
Cytip A T 2: 58,147,899 I151N probably damaging Het
Dnah10 A G 5: 124,832,513 T4399A possibly damaging Het
Dock3 A T 9: 106,969,781 I883N probably damaging Het
Entpd3 A G 9: 120,566,542 *530W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8989 T C 7: 106,329,889 noncoding transcript Het
Gp1ba G A 11: 70,641,399 V664M probably benign Het
Gpd2 T A 2: 57,355,901 I481N probably damaging Het
Ildr2 A G 1: 166,307,762 D342G probably damaging Het
Krt83 A G 15: 101,487,510 I327T probably benign Het
Lats1 T A 10: 7,712,584 C988* probably null Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mast4 T C 13: 102,736,356 D2168G probably benign Het
Myo6 G T 9: 80,270,039 E606* probably null Het
Nek7 A G 1: 138,515,693 V174A probably benign Het
Nid1 T A 13: 13,483,754 C695S probably damaging Het
Nme8 A G 13: 19,690,847 probably null Het
Nr2c2 T C 6: 92,154,516 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1013 A G 2: 85,769,924 N41S probably damaging Het
Olfr1265 A G 2: 90,037,047 M43V probably benign Het
Olfr613 G A 7: 103,551,943 E53K probably damaging Het
Olfr700 A T 7: 106,806,213 I83K possibly damaging Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Psapl1 T A 5: 36,204,150 C29S probably damaging Het
Scn3a A T 2: 65,461,506 V1632D probably damaging Het
Slc22a1 C T 17: 12,667,242 G168D probably damaging Het
Smad4 A G 18: 73,675,860 V112A probably benign Het
Smc4 T C 3: 69,028,512 V796A probably benign Het
Smco4 A G 9: 15,544,672 E18G unknown Het
Sugp2 A G 8: 70,260,489 E1035G probably damaging Het
Syde2 T C 3: 146,015,638 S820P probably damaging Het
Syn2 T C 6: 115,263,899 L410P probably damaging Het
Tmem131l T C 3: 83,937,504 N466S probably damaging Het
Unc79 T C 12: 103,112,510 S1645P probably damaging Het
Vmn2r17 A T 5: 109,428,351 S363C probably damaging Het
Vmn2r78 T C 7: 86,922,355 Y458H probably damaging Het
Other mutations in Uba1y
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Uba1y APN Y 828841 nonsense probably null
R0532:Uba1y UTSW Y 820911 missense probably benign 0.28
R1532:Uba1y UTSW Y 828862 missense probably benign 0.44
R1590:Uba1y UTSW Y 826893 missense probably damaging 1.00
R4668:Uba1y UTSW Y 826032 missense possibly damaging 0.95
R4801:Uba1y UTSW Y 825890 splice site probably null
R4802:Uba1y UTSW Y 825890 splice site probably null
R6151:Uba1y UTSW Y 825984 missense probably benign 0.01
R6577:Uba1y UTSW Y 825465 missense probably benign 0.39
R6901:Uba1y UTSW Y 825496 missense probably benign 0.03
R7186:Uba1y UTSW Y 825537 missense probably benign
R7263:Uba1y UTSW Y 822200 missense possibly damaging 0.85
R7305:Uba1y UTSW Y 821348 missense probably damaging 1.00
R7519:Uba1y UTSW Y 821567 missense probably benign 0.44
R7873:Uba1y UTSW Y 825542 missense probably benign
R7956:Uba1y UTSW Y 825542 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGTGTGGAAATTGCCAAG -3'
(R):5'- AACCAGATCTGACACAAGGTG -3'

Sequencing Primer
(F):5'- GCCAAGAATATCATCCTTGGTGG -3'
(R):5'- GATCTGACACAAGGTGCCAAC -3'
Posted On2016-06-15