Mutagenetix > Incidental Mutations

Incidental Mutation 'R5102:Cps1'

392391

Institutional Source

Beutler Lab

Gene Symbol

Cps1

Ensembl Gene

ENSMUSG00000025991

Gene Name

carbamoyl-phosphate synthetase 1

Synonyms

CPSase I, D1Ucla3, CPS, 4732433M03Rik

MMRRC Submission

042690-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67123026-67231259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67206793 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1148 (M1148L)

Ref Sequence

ENSEMBL: ENSMUSP00000027144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027144]

Predicted Effect

probably benign
Transcript: ENSMUST00000027144
AA Change: M1148L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: M1148L

Domain	Start	End	E-Value	Type
CPSase_sm_chain	44	184	2.5e-70	SMART
Pfam:GATase	221	397	1.5e-40	PFAM
low complexity region	426	436	N/A	INTRINSIC
Pfam:ATP-grasp_4	543	724	6.8e-12	PFAM
Pfam:CPSase_L_D2	546	750	1.7e-85	PFAM
Pfam:ATP-grasp	554	722	4.9e-8	PFAM
Pfam:Dala_Dala_lig_C	561	718	1.5e-7	PFAM
CPSase_L_D3	839	962	1.18e-57	SMART
Pfam:ATP-grasp_4	1085	1264	1e-19	PFAM
Pfam:CPSase_L_D2	1088	1291	7.4e-32	PFAM
Pfam:Dala_Dala_lig_C	1095	1279	1.6e-6	PFAM
Pfam:ATP-grasp	1096	1263	2.8e-12	PFAM
MGS	1373	1465	1.53e-15	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Cps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Cps1	APN	1	67152380	splice site	probably benign
IGL00897:Cps1	APN	1	67215564	missense	probably benign	0.08
IGL00928:Cps1	APN	1	67123234	missense	probably benign
IGL01063:Cps1	APN	1	67195166	missense	possibly damaging	0.91
IGL01081:Cps1	APN	1	67206824	missense	probably damaging	1.00
IGL01361:Cps1	APN	1	67195145	missense	probably benign	0.03
IGL01396:Cps1	APN	1	67157786	missense	probably damaging	1.00
IGL01516:Cps1	APN	1	67230284	missense	probably damaging	0.99
IGL01695:Cps1	APN	1	67197035	missense	probably benign
IGL02022:Cps1	APN	1	67172872	splice site	probably benign
IGL02032:Cps1	APN	1	67230315	missense	probably benign	0.03
IGL02049:Cps1	APN	1	67143954	missense	possibly damaging	0.68
IGL02197:Cps1	APN	1	67157764	missense	probably benign
IGL02217:Cps1	APN	1	67174382	missense	probably benign	0.06
IGL02555:Cps1	APN	1	67214021	missense	probably benign	0.06
IGL02570:Cps1	APN	1	67148703	splice site	probably benign
IGL02633:Cps1	APN	1	67123237	missense	probably benign
IGL02711:Cps1	APN	1	67212517	splice site	probably benign
IGL02737:Cps1	APN	1	67148774	missense	probably benign	0.35
IGL03030:Cps1	APN	1	67142921	missense	probably damaging	1.00
IGL03255:Cps1	APN	1	67145801	nonsense	probably null
Madman	UTSW	1	67160871	missense	probably damaging	0.96
maniac	UTSW	1	67157878	critical splice donor site	probably null
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0140:Cps1	UTSW	1	67180116	missense	probably benign
R0318:Cps1	UTSW	1	67177014	missense	probably damaging	0.99
R0486:Cps1	UTSW	1	67165392	missense	probably damaging	1.00
R0488:Cps1	UTSW	1	67148808	splice site	probably benign
R0492:Cps1	UTSW	1	67157836	missense	probably damaging	1.00
R0521:Cps1	UTSW	1	67215564	missense	probably benign	0.02
R0534:Cps1	UTSW	1	67143900	missense	probably benign	0.06
R0565:Cps1	UTSW	1	67166449	missense	possibly damaging	0.57
R0609:Cps1	UTSW	1	67172802	missense	probably damaging	1.00
R0612:Cps1	UTSW	1	67139770	missense	probably benign	0.01
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1220:Cps1	UTSW	1	67204703	critical splice donor site	probably null
R1321:Cps1	UTSW	1	67143019	splice site	probably benign
R1343:Cps1	UTSW	1	67209609	missense	probably damaging	1.00
R1373:Cps1	UTSW	1	67229424	missense	possibly damaging	0.89
R1374:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1481:Cps1	UTSW	1	67143882	missense	probably damaging	0.99
R1711:Cps1	UTSW	1	67168374	splice site	probably null
R1712:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1774:Cps1	UTSW	1	67170882	missense	possibly damaging	0.94
R1799:Cps1	UTSW	1	67209642	missense	probably damaging	1.00
R1954:Cps1	UTSW	1	67195196	missense	possibly damaging	0.71
R2074:Cps1	UTSW	1	67204638	missense	probably benign	0.21
R2078:Cps1	UTSW	1	67157806	missense	probably damaging	1.00
R2078:Cps1	UTSW	1	67195265	missense	possibly damaging	0.74
R2111:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2112:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2146:Cps1	UTSW	1	67152379	splice site	probably benign
R2355:Cps1	UTSW	1	67156224	missense	probably damaging	1.00
R2375:Cps1	UTSW	1	67217860	missense	probably benign	0.00
R2860:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2861:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2979:Cps1	UTSW	1	67204704	critical splice donor site	probably null
R3427:Cps1	UTSW	1	67174494	missense	probably damaging	1.00
R3833:Cps1	UTSW	1	67139787	missense	probably damaging	1.00
R3857:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3858:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3859:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3886:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3887:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3888:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3889:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R4386:Cps1	UTSW	1	67170995	critical splice donor site	probably null
R4497:Cps1	UTSW	1	67205199	missense	probably null	1.00
R4671:Cps1	UTSW	1	67196560	missense	probably damaging	1.00
R4774:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R4799:Cps1	UTSW	1	67142986	missense	probably damaging	0.96
R4853:Cps1	UTSW	1	67156202	missense	possibly damaging	0.51
R4884:Cps1	UTSW	1	67177024	missense	probably benign	0.11
R4900:Cps1	UTSW	1	67160904	missense	probably damaging	1.00
R4906:Cps1	UTSW	1	67139763	missense	probably benign	0.10
R5091:Cps1	UTSW	1	67229520	critical splice donor site	probably null
R5215:Cps1	UTSW	1	67166380	missense	possibly damaging	0.62
R5290:Cps1	UTSW	1	67172709	missense	probably benign	0.21
R5732:Cps1	UTSW	1	67157764	missense	probably benign	0.22
R5818:Cps1	UTSW	1	67166488	missense	possibly damaging	0.96
R5878:Cps1	UTSW	1	67157878	critical splice donor site	probably null
R6002:Cps1	UTSW	1	67172755	missense	possibly damaging	0.94
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6199:Cps1	UTSW	1	67162615	frame shift	probably null
R6310:Cps1	UTSW	1	67142981	missense	probably benign	0.00
R6554:Cps1	UTSW	1	67174469	nonsense	probably null
R6700:Cps1	UTSW	1	67229523	splice site	probably null
R6731:Cps1	UTSW	1	67160871	missense	probably damaging	0.96
R7052:Cps1	UTSW	1	67198410	missense	probably damaging	1.00
R7278:Cps1	UTSW	1	67170921	missense	probably damaging	1.00
R7313:Cps1	UTSW	1	67198358	missense	probably damaging	0.99
R7323:Cps1	UTSW	1	67157869	missense	probably benign	0.03
R7339:Cps1	UTSW	1	67197015	missense	possibly damaging	0.64
R7485:Cps1	UTSW	1	67139857	missense	probably damaging	1.00
R7505:Cps1	UTSW	1	67180081	missense	probably benign
R7748:Cps1	UTSW	1	67139806	missense	probably damaging	1.00
R7853:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
R8097:Cps1	UTSW	1	67228270	missense	probably benign	0.08
R8357:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8435:Cps1	UTSW	1	67212430	missense	probably benign	0.07
R8457:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8680:Cps1	UTSW	1	67204613	missense	probably damaging	1.00
R8805:Cps1	UTSW	1	67176951	missense	probably damaging	1.00
R8811:Cps1	UTSW	1	67214087	missense	probably benign	0.03
R8819:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
R8820:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
X0024:Cps1	UTSW	1	67123247	missense	probably benign
Z1176:Cps1	UTSW	1	67123268	missense	possibly damaging	0.54
Z1176:Cps1	UTSW	1	67148719	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CATGGAATTAAAACGCAGCTTAGAC -3'
(R):5'- TGAAAGATGCCCAGGTCTTCTG -3'

Sequencing Primer
(F):5'- GCAGCTTAGACAAAAAGATACCTTTC -3'
(R):5'- CCAGCCATCACTTAAAGACATTTTTC -3'

Posted On

2016-06-15