Mutagenetix > Incidental Mutations

Incidental Mutation 'R5102:Dner'

392393

Institutional Source

Beutler Lab

Gene Symbol

Dner

Ensembl Gene

ENSMUSG00000036766

Gene Name

delta/notch-like EGF repeat containing

Synonyms

A930026D19Rik, BET

MMRRC Submission

042690-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5102 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

84369839-84696221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84405970 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 564 (N564K)

Ref Sequence

ENSEMBL: ENSMUSP00000042927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049126]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049126
AA Change: N564K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: N564K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
EGF	47	92	9.85e-5	SMART
EGF	97	133	2.33e-6	SMART
EGF	306	348	1.8e1	SMART
EGF	352	390	5e-6	SMART
EGF_CA	392	428	8.97e-8	SMART
EGF	433	466	3.54e-6	SMART
EGF	471	503	4.66e-6	SMART
EGF_CA	505	541	1.61e-9	SMART
EGF	546	579	9.7e-4	SMART
EGF_CA	581	617	4.52e-13	SMART
transmembrane domain	639	661	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Dner

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Dner	APN	1	84384010	missense	probably benign	0.13
IGL02251:Dner	APN	1	84384026	missense	probably damaging	1.00
IGL02904:Dner	APN	1	84534944	missense	probably damaging	0.96
IGL03063:Dner	APN	1	84585338	missense	possibly damaging	0.90
R0013:Dner	UTSW	1	84494893	splice site	probably benign
R0112:Dner	UTSW	1	84583053	missense	probably benign	0.06
R0196:Dner	UTSW	1	84370832	missense	probably damaging	1.00
R0282:Dner	UTSW	1	84405965	missense	probably damaging	1.00
R0282:Dner	UTSW	1	84445380	splice site	probably benign
R0942:Dner	UTSW	1	84585309	splice site	probably benign
R1143:Dner	UTSW	1	84445464	missense	probably damaging	1.00
R1483:Dner	UTSW	1	84585549	utr 5 prime	probably benign
R1585:Dner	UTSW	1	84585456	missense	probably benign	0.05
R1636:Dner	UTSW	1	84585330	missense	possibly damaging	0.89
R1739:Dner	UTSW	1	84370784	missense	probably damaging	0.99
R1756:Dner	UTSW	1	84445590	missense	probably damaging	0.98
R1960:Dner	UTSW	1	84445456	missense	probably damaging	0.98
R2061:Dner	UTSW	1	84405989	missense	probably damaging	1.00
R2157:Dner	UTSW	1	84383938	missense	possibly damaging	0.88
R2265:Dner	UTSW	1	84585549	utr 5 prime	probably benign
R2382:Dner	UTSW	1	84370823	missense	probably damaging	1.00
R2507:Dner	UTSW	1	84583080	missense	probably damaging	1.00
R3053:Dner	UTSW	1	84384026	missense	probably damaging	1.00
R3917:Dner	UTSW	1	84585549	utr 5 prime	probably benign
R4530:Dner	UTSW	1	84583015	missense	probably damaging	1.00
R4552:Dner	UTSW	1	84383857	missense	probably damaging	1.00
R4579:Dner	UTSW	1	84383816	missense	probably damaging	0.97
R4593:Dner	UTSW	1	84695728	start codon destroyed	probably null
R4711:Dner	UTSW	1	84383897	missense	possibly damaging	0.75
R5314:Dner	UTSW	1	84580739	missense	probably damaging	1.00
R5370:Dner	UTSW	1	84585549	utr 5 prime	probably benign
R6000:Dner	UTSW	1	84383929	missense	possibly damaging	0.80
R6644:Dner	UTSW	1	84395707	missense	probably damaging	1.00
R6764:Dner	UTSW	1	84494781	missense	probably damaging	1.00
R6948:Dner	UTSW	1	84406017	missense	probably damaging	1.00
R6991:Dner	UTSW	1	84476402	nonsense	probably null
R7056:Dner	UTSW	1	84580736	missense	possibly damaging	0.75
R7410:Dner	UTSW	1	84585611	missense	probably damaging	1.00
R7490:Dner	UTSW	1	84585549	utr 5 prime	probably benign
R7869:Dner	UTSW	1	84383881	missense	probably benign	0.10
R7952:Dner	UTSW	1	84383881	missense	probably benign	0.10
Z1176:Dner	UTSW	1	84383980	missense	possibly damaging	0.88
Z1177:Dner	UTSW	1	84405989	missense	probably damaging	1.00
Z1177:Dner	UTSW	1	84445430	missense	probably damaging	1.00
Z1177:Dner	UTSW	1	84445433	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGCAGTTGCAGCAAATCTAAATG -3'
(R):5'- ATGCTAGTGAAACACCTCCC -3'

Sequencing Primer
(F):5'- GAAGAGACTTTAATGACAACACAGTC -3'
(R):5'- CTAGTGAAACACCTCCCTTTTGAAGG -3'

Posted On

2016-06-15