Mutagenetix > Incidental Mutation

Incidental Mutation 'R5102:Kif14'

392395

Institutional Source

Beutler Lab

Gene Symbol

Kif14

Ensembl Gene

ENSMUSG00000041498

Gene Name

kinesin family member 14

Synonyms

N-3 kinesin, D1Ertd367e

MMRRC Submission

042690-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136466343-136531511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136516403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1378 (I1378V)

Ref Sequence

ENSEMBL: ENSMUSP00000139698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]

AlphaFold

L0N7N1

PDB Structure

Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000047817
AA Change: I1328V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: I1328V

Domain	Start	End	E-Value	Type
KISc	341	694	1.45e-180	SMART
FHA	809	861	1.46e-7	SMART
coiled coil region	911	1060	N/A	INTRINSIC
low complexity region	1169	1179	N/A	INTRINSIC
low complexity region	1548	1559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189413
AA Change: I1378V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: I1378V

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	744	1.45e-180	SMART
FHA	859	911	1.46e-7	SMART
coiled coil region	961	1110	N/A	INTRINSIC
low complexity region	1219	1229	N/A	INTRINSIC
low complexity region	1598	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201676

SMART Domains

Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	497	3.7e-6	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Kif14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00159:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00160:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00164:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00310:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00330:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00335:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00434:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00468:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL01330:Kif14	APN	1	136476374	missense	probably damaging	0.99
IGL01530:Kif14	APN	1	136478419	splice site	probably benign
IGL01622:Kif14	APN	1	136497356	splice site	probably benign
IGL01689:Kif14	APN	1	136519642	missense	probably damaging	0.99
IGL02115:Kif14	APN	1	136496567	splice site	probably benign
IGL02252:Kif14	APN	1	136478392	missense	probably damaging	1.00
IGL02259:Kif14	APN	1	136500102	missense	probably benign
IGL02439:Kif14	APN	1	136490261	missense	probably damaging	1.00
IGL02590:Kif14	APN	1	136496004	missense	probably benign	0.00
IGL02606:Kif14	APN	1	136496593	missense	probably damaging	1.00
IGL03253:Kif14	APN	1	136487460	missense	probably damaging	0.97
R0106:Kif14	UTSW	1	136479924	splice site	probably benign
R0193:Kif14	UTSW	1	136468438	missense	probably benign	0.00
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0329:Kif14	UTSW	1	136496026	splice site	probably benign
R0346:Kif14	UTSW	1	136468160	missense	probably damaging	1.00
R0393:Kif14	UTSW	1	136482418	missense	probably damaging	1.00
R0519:Kif14	UTSW	1	136469147	missense	probably damaging	1.00
R0590:Kif14	UTSW	1	136482472	missense	probably damaging	0.97
R0633:Kif14	UTSW	1	136527305	missense	probably damaging	0.96
R0657:Kif14	UTSW	1	136469102	missense	probably benign	0.07
R0831:Kif14	UTSW	1	136525871	splice site	probably benign
R0971:Kif14	UTSW	1	136519654	missense	probably damaging	0.98
R1018:Kif14	UTSW	1	136495841	splice site	probably benign
R1520:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R1713:Kif14	UTSW	1	136527464	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136468279	missense	probably benign
R1728:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1728:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136490332	missense	probably benign
R1728:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1728:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1728:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1729:Kif14	UTSW	1	136468279	missense	probably benign
R1729:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1729:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1729:Kif14	UTSW	1	136490332	missense	probably benign
R1729:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1729:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1729:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1730:Kif14	UTSW	1	136468279	missense	probably benign
R1730:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1730:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1730:Kif14	UTSW	1	136490332	missense	probably benign
R1730:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1730:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1730:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1739:Kif14	UTSW	1	136468279	missense	probably benign
R1739:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1739:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1739:Kif14	UTSW	1	136490332	missense	probably benign
R1739:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1739:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1739:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1762:Kif14	UTSW	1	136468279	missense	probably benign
R1762:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1762:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1762:Kif14	UTSW	1	136490332	missense	probably benign
R1762:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1762:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1762:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1783:Kif14	UTSW	1	136468279	missense	probably benign
R1783:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1783:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1783:Kif14	UTSW	1	136490332	missense	probably benign
R1783:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1783:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1783:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1784:Kif14	UTSW	1	136468279	missense	probably benign
R1784:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1784:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1784:Kif14	UTSW	1	136490332	missense	probably benign
R1784:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1784:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1784:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1785:Kif14	UTSW	1	136468279	missense	probably benign
R1785:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1785:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1785:Kif14	UTSW	1	136490332	missense	probably benign
R1785:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1785:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1785:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1872:Kif14	UTSW	1	136486358	missense	probably damaging	1.00
R2049:Kif14	UTSW	1	136487080	missense	probably benign
R2049:Kif14	UTSW	1	136510167	missense	possibly damaging	0.68
R2268:Kif14	UTSW	1	136519748	nonsense	probably null
R2373:Kif14	UTSW	1	136479845	missense	probably damaging	1.00
R3076:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3077:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3078:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R4232:Kif14	UTSW	1	136516363	nonsense	probably null
R4246:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4247:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4250:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4672:Kif14	UTSW	1	136521278	missense	probably benign	0.00
R4672:Kif14	UTSW	1	136521279	missense	probably benign
R4890:Kif14	UTSW	1	136487130	missense	possibly damaging	0.91
R4994:Kif14	UTSW	1	136482959	missense	probably damaging	1.00
R5185:Kif14	UTSW	1	136527469	nonsense	probably null
R5201:Kif14	UTSW	1	136503407	missense	probably benign	0.00
R5399:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R5431:Kif14	UTSW	1	136496695	missense	possibly damaging	0.91
R5932:Kif14	UTSW	1	136516390	missense	probably benign	0.23
R6027:Kif14	UTSW	1	136483059	splice site	probably null
R6246:Kif14	UTSW	1	136476424	nonsense	probably null
R6331:Kif14	UTSW	1	136515986	missense	probably null	1.00
R6448:Kif14	UTSW	1	136503347	missense	probably damaging	0.99
R6453:Kif14	UTSW	1	136482304	splice site	probably null
R6475:Kif14	UTSW	1	136527411	missense	probably damaging	1.00
R6631:Kif14	UTSW	1	136515959	missense	probably benign	0.39
R6713:Kif14	UTSW	1	136525806	missense	probably benign
R7173:Kif14	UTSW	1	136479170	missense	probably damaging	0.98
R7174:Kif14	UTSW	1	136521257	missense	possibly damaging	0.67
R7241:Kif14	UTSW	1	136468753	missense	probably benign	0.41
R7674:Kif14	UTSW	1	136468820	missense	probably damaging	0.99
R7688:Kif14	UTSW	1	136494654	missense	probably damaging	1.00
R7711:Kif14	UTSW	1	136471453	missense	probably benign	0.10
R7722:Kif14	UTSW	1	136468295	missense	probably benign	0.00
R7763:Kif14	UTSW	1	136516383	missense	probably benign	0.00
R7882:Kif14	UTSW	1	136471576	critical splice donor site	probably null
R7882:Kif14	UTSW	1	136516025	missense	probably benign	0.43
R8077:Kif14	UTSW	1	136471448	missense	possibly damaging	0.87
R8101:Kif14	UTSW	1	136476352	missense	probably benign	0.14
R8308:Kif14	UTSW	1	136515913	missense	possibly damaging	0.90
R8338:Kif14	UTSW	1	136494678	missense	probably damaging	1.00
R8527:Kif14	UTSW	1	136468757	missense	possibly damaging	0.95
R8542:Kif14	UTSW	1	136468757	missense	possibly damaging	0.95
R8884:Kif14	UTSW	1	136486351	missense
R9435:Kif14	UTSW	1	136473436	missense	possibly damaging	0.92
R9499:Kif14	UTSW	1	136527481	missense	probably damaging	0.96
R9551:Kif14	UTSW	1	136527481	missense	probably damaging	0.96
R9577:Kif14	UTSW	1	136471400	missense	probably benign	0.00
X0021:Kif14	UTSW	1	136490276	missense	probably damaging	1.00
Z1176:Kif14	UTSW	1	136496653	missense	probably damaging	0.97
Z1176:Kif14	UTSW	1	136500016	critical splice acceptor site	probably null
Z1177:Kif14	UTSW	1	136478365	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCTTCGATGCTTCAATGGC -3'
(R):5'- AGTCTTAGGACCTCAAAACAGG -3'

Sequencing Primer
(F):5'- CGATGCTTCAATGGCAACTG -3'
(R):5'- TCTTAGGACCTCAAAACAGGAAGCAC -3'

Posted On

2016-06-15