Incidental Mutation 'R5102:Lhx3'
ID392397
Institutional Source Beutler Lab
Gene Symbol Lhx3
Ensembl Gene ENSMUSG00000026934
Gene NameLIM homeobox protein 3
SynonymsmLim-3, Lim3, P-LIM
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5102 (G1)
Quality Score111
Status Not validated
Chromosome2
Chromosomal Location26200212-26208289 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCTACGGGCCGGCCC to TCC at 26201423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028302] [ENSMUST00000054099]
PDB Structure
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000028302
SMART Domains Protein: ENSMUSP00000028302
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
LIM 35 86 4.18e-17 SMART
LIM 94 149 7.8e-17 SMART
HOX 162 224 7.13e-23 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054099
SMART Domains Protein: ENSMUSP00000056822
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
LIM 33 84 4.18e-17 SMART
LIM 92 147 7.8e-17 SMART
HOX 160 222 7.13e-23 SMART
low complexity region 235 247 N/A INTRINSIC
low complexity region 321 340 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127035
SMART Domains Protein: ENSMUSP00000134884
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 6.2e-5 PFAM
low complexity region 35 47 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149637
SMART Domains Protein: ENSMUSP00000135765
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failure of growth and differentiation of Rathke's pouch, lack both anterior and intermediate lobes of the pituitary gland, and die perinatally, within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Lhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Lhx3 APN 2 26201373 missense probably benign
IGL02691:Lhx3 APN 2 26203085 missense probably damaging 1.00
R0267:Lhx3 UTSW 2 26203028 missense probably benign 0.02
R0571:Lhx3 UTSW 2 26201124 missense probably damaging 1.00
R0574:Lhx3 UTSW 2 26201311 missense probably benign 0.00
R1866:Lhx3 UTSW 2 26203974 missense probably damaging 0.99
R1926:Lhx3 UTSW 2 26202188 nonsense probably null
R1940:Lhx3 UTSW 2 26203962 missense probably benign 0.05
R3147:Lhx3 UTSW 2 26201265 missense probably benign 0.01
R4389:Lhx3 UTSW 2 26201090 utr 3 prime probably benign
R4534:Lhx3 UTSW 2 26204014 missense probably benign
R4551:Lhx3 UTSW 2 26201190 missense probably damaging 1.00
R4761:Lhx3 UTSW 2 26201423 frame shift probably null
R5105:Lhx3 UTSW 2 26201423 frame shift probably null
R5431:Lhx3 UTSW 2 26201118 missense probably damaging 1.00
R5673:Lhx3 UTSW 2 26202994 missense probably damaging 1.00
R5751:Lhx3 UTSW 2 26201161 missense probably benign
R6180:Lhx3 UTSW 2 26201491 missense probably benign
R6262:Lhx3 UTSW 2 26202423 small deletion probably benign
R7238:Lhx3 UTSW 2 26202997 missense probably damaging 1.00
Z1176:Lhx3 UTSW 2 26203987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCTCAAGTTGGTGTCTG -3'
(R):5'- AGTGCTGAAGAGACTGTCCC -3'

Sequencing Primer
(F):5'- CTCAAGTTGGTGTCTGGGTATACC -3'
(R):5'- TGAAGAGACTGTCCCTGACC -3'
Posted On2016-06-15