Incidental Mutation 'R5102:D3Ertd254e'
ID392405
Institutional Source Beutler Lab
Gene Symbol D3Ertd254e
Ensembl Gene ENSMUSG00000033883
Gene NameDNA segment, Chr 3, ERATO Doi 254, expressed
Synonyms
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36151017-36170342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36162665 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 55 (C55Y)
Ref Sequence ENSEMBL: ENSMUSP00000142829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165956] [ENSMUST00000197653] [ENSMUST00000205077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165956
AA Change: C54Y

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131779
Gene: ENSMUSG00000033883
AA Change: C54Y

DomainStartEndE-ValueType
KRAB 3 63 2.91e-34 SMART
ZnF_C2H2 342 364 1.08e-1 SMART
ZnF_C2H2 395 417 1.56e-2 SMART
ZnF_C2H2 423 445 3.11e-2 SMART
ZnF_C2H2 451 473 5.9e-3 SMART
ZnF_C2H2 479 501 1.82e-3 SMART
ZnF_C2H2 507 529 5.21e-4 SMART
ZnF_C2H2 535 557 1.84e-4 SMART
ZnF_C2H2 563 585 1.95e-3 SMART
ZnF_C2H2 591 613 2.05e-2 SMART
ZnF_C2H2 619 641 1.6e-4 SMART
ZnF_C2H2 647 669 5.21e-4 SMART
ZnF_C2H2 675 697 1.69e-3 SMART
ZnF_C2H2 703 725 2.61e-4 SMART
ZnF_C2H2 731 753 1.12e-3 SMART
ZnF_C2H2 759 779 3.85e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197653
AA Change: C55Y

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142829
Gene: ENSMUSG00000033883
AA Change: C55Y

DomainStartEndE-ValueType
KRAB 4 64 1.2e-36 SMART
ZnF_C2H2 343 365 4.4e-4 SMART
ZnF_C2H2 396 418 6.7e-5 SMART
ZnF_C2H2 424 446 1.3e-4 SMART
ZnF_C2H2 452 474 2.5e-5 SMART
ZnF_C2H2 480 502 7.9e-6 SMART
ZnF_C2H2 508 530 2.2e-6 SMART
ZnF_C2H2 536 558 7.7e-7 SMART
ZnF_C2H2 564 586 8e-6 SMART
ZnF_C2H2 592 614 8.9e-5 SMART
ZnF_C2H2 620 642 6.6e-7 SMART
ZnF_C2H2 648 670 2.2e-6 SMART
ZnF_C2H2 676 698 7.1e-6 SMART
ZnF_C2H2 704 726 1.1e-6 SMART
ZnF_C2H2 732 754 4.8e-6 SMART
ZnF_C2H2 760 780 1.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205077
AA Change: C23Y

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in D3Ertd254e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:D3Ertd254e APN 3 36164580 missense possibly damaging 0.86
IGL02089:D3Ertd254e APN 3 36164728 missense possibly damaging 0.53
IGL02162:D3Ertd254e APN 3 36164061 missense probably benign 0.18
R0243:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R0512:D3Ertd254e UTSW 3 36166113 missense probably damaging 0.96
R0722:D3Ertd254e UTSW 3 36165069 missense probably benign 0.35
R0762:D3Ertd254e UTSW 3 36165867 missense possibly damaging 0.92
R0792:D3Ertd254e UTSW 3 36164562 missense probably benign 0.01
R0894:D3Ertd254e UTSW 3 36164786 nonsense probably null
R1731:D3Ertd254e UTSW 3 36164471 missense probably benign 0.18
R2098:D3Ertd254e UTSW 3 36166140 missense probably benign
R2099:D3Ertd254e UTSW 3 36164212 missense possibly damaging 0.86
R3709:D3Ertd254e UTSW 3 36159576 missense possibly damaging 0.71
R3808:D3Ertd254e UTSW 3 36165643 unclassified probably null
R4035:D3Ertd254e UTSW 3 36164840 missense possibly damaging 0.53
R4288:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4289:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4959:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R4973:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R5462:D3Ertd254e UTSW 3 36165820 missense possibly damaging 0.95
R5548:D3Ertd254e UTSW 3 36165491 missense possibly damaging 0.90
R5782:D3Ertd254e UTSW 3 36164979 missense possibly damaging 0.73
R6153:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R6225:D3Ertd254e UTSW 3 36166203 missense probably benign 0.18
R6602:D3Ertd254e UTSW 3 36164855 missense possibly damaging 0.86
R6785:D3Ertd254e UTSW 3 36165452 nonsense probably null
R7513:D3Ertd254e UTSW 3 36164643 missense possibly damaging 0.53
X0021:D3Ertd254e UTSW 3 36164191 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTCTGTAGGGAAACAACAATTGG -3'
(R):5'- ACTGCAGGACAATGAGGCTC -3'

Sequencing Primer
(F):5'- AAACAACAATTGGAAAAGTAATGGTC -3'
(R):5'- ATGCCCTTCGGTGACAAAG -3'
Posted On2016-06-15