Incidental Mutation 'R5102:Golim4'
ID392406
Institutional Source Beutler Lab
Gene Symbol Golim4
Ensembl Gene ENSMUSG00000034109
Gene Namegolgi integral membrane protein 4
Synonyms3110027H23Rik, P138, Golph4, GPP130
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location75875084-75956949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75903272 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 192 (I192T)
Ref Sequence ENSEMBL: ENSMUSP00000114006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038563] [ENSMUST00000117242] [ENSMUST00000167078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038563
AA Change: I192T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048997
Gene: ENSMUSG00000034109
AA Change: I192T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 211 N/A INTRINSIC
coiled coil region 295 326 N/A INTRINSIC
coiled coil region 371 402 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
internal_repeat_1 472 524 2.99e-6 PROSPERO
low complexity region 538 550 N/A INTRINSIC
internal_repeat_1 573 618 2.99e-6 PROSPERO
low complexity region 634 641 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117242
AA Change: I192T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114006
Gene: ENSMUSG00000034109
AA Change: I192T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 244 N/A INTRINSIC
coiled coil region 323 354 N/A INTRINSIC
coiled coil region 399 430 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
internal_repeat_1 500 552 7.18e-7 PROSPERO
low complexity region 566 578 N/A INTRINSIC
internal_repeat_1 601 646 7.18e-7 PROSPERO
low complexity region 662 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131987
Predicted Effect probably benign
Transcript: ENSMUST00000150904
SMART Domains Protein: ENSMUSP00000119501
Gene: ENSMUSG00000034109

DomainStartEndE-ValueType
coiled coil region 89 120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167078
AA Change: I192T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132910
Gene: ENSMUSG00000034109
AA Change: I192T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 211 N/A INTRINSIC
coiled coil region 295 326 N/A INTRINSIC
coiled coil region 371 402 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
internal_repeat_1 472 524 2.99e-6 PROSPERO
low complexity region 538 550 N/A INTRINSIC
internal_repeat_1 573 618 2.99e-6 PROSPERO
low complexity region 634 641 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi-resident protein. It may process proteins synthesized in the rough endoplasmic reticulum and assist in the transport of protein cargo through the Golgi apparatus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Golim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Golim4 APN 3 75886311 missense probably damaging 1.00
IGL01540:Golim4 APN 3 75886740 missense possibly damaging 0.81
IGL01548:Golim4 APN 3 75908125 splice site probably null
IGL01552:Golim4 APN 3 75956195 missense probably damaging 1.00
IGL02218:Golim4 APN 3 75878054 missense probably damaging 1.00
IGL02935:Golim4 APN 3 75894992 missense possibly damaging 0.86
IGL03087:Golim4 APN 3 75878673 missense possibly damaging 0.94
R1314:Golim4 UTSW 3 75886288 missense probably damaging 1.00
R1436:Golim4 UTSW 3 75878644 critical splice donor site probably null
R1438:Golim4 UTSW 3 75956133 missense probably damaging 0.99
R1686:Golim4 UTSW 3 75895136 missense probably benign 0.00
R1785:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R1786:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R1828:Golim4 UTSW 3 75902438 missense probably damaging 1.00
R2057:Golim4 UTSW 3 75894887 missense possibly damaging 0.62
R2130:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2131:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2133:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2432:Golim4 UTSW 3 75891942 missense possibly damaging 0.93
R2517:Golim4 UTSW 3 75892859 missense probably benign 0.01
R3915:Golim4 UTSW 3 75903327 missense probably damaging 1.00
R4414:Golim4 UTSW 3 75895040 missense probably benign 0.00
R4976:Golim4 UTSW 3 75878643 splice site probably null
R5619:Golim4 UTSW 3 75906495 nonsense probably null
R7051:Golim4 UTSW 3 75893002 missense probably benign 0.07
R7058:Golim4 UTSW 3 75878650 missense probably damaging 1.00
R7303:Golim4 UTSW 3 75878053 missense probably damaging 1.00
R7484:Golim4 UTSW 3 75898135 splice site probably null
R7681:Golim4 UTSW 3 75887024 splice site probably null
R7702:Golim4 UTSW 3 75886784 missense probably damaging 1.00
R8354:Golim4 UTSW 3 75895001 missense probably damaging 1.00
X0062:Golim4 UTSW 3 75906419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGATGAGCTCGCAAAG -3'
(R):5'- CCCAATACTTTGCTGTTGAAGTTC -3'

Sequencing Primer
(F):5'- CAAGGACATTAGATTCCCTGGAGTTG -3'
(R):5'- GCTGTTGAAGTTCAAAATACACCTTG -3'
Posted On2016-06-15