Mutagenetix > Incidental Mutations

Incidental Mutation 'R5102:Golim4'

392406

Institutional Source

Beutler Lab

Gene Symbol

Golim4

Ensembl Gene

ENSMUSG00000034109

Gene Name

golgi integral membrane protein 4

Synonyms

3110027H23Rik, P138, Golph4, GPP130

MMRRC Submission

042690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75875084-75956949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75903272 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 192 (I192T)

Ref Sequence

ENSEMBL: ENSMUSP00000114006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038563] [ENSMUST00000117242] [ENSMUST00000167078]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038563
AA Change: I192T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048997
Gene: ENSMUSG00000034109
AA Change: I192T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
coiled coil region	108	211	N/A	INTRINSIC
coiled coil region	295	326	N/A	INTRINSIC
coiled coil region	371	402	N/A	INTRINSIC
low complexity region	432	442	N/A	INTRINSIC
internal_repeat_1	472	524	2.99e-6	PROSPERO
low complexity region	538	550	N/A	INTRINSIC
internal_repeat_1	573	618	2.99e-6	PROSPERO
low complexity region	634	641	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117242
AA Change: I192T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114006
Gene: ENSMUSG00000034109
AA Change: I192T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
coiled coil region	108	244	N/A	INTRINSIC
coiled coil region	323	354	N/A	INTRINSIC
coiled coil region	399	430	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
internal_repeat_1	500	552	7.18e-7	PROSPERO
low complexity region	566	578	N/A	INTRINSIC
internal_repeat_1	601	646	7.18e-7	PROSPERO
low complexity region	662	669	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131987

Predicted Effect

probably benign
Transcript: ENSMUST00000150904

SMART Domains

Protein: ENSMUSP00000119501
Gene: ENSMUSG00000034109

Domain	Start	End	E-Value	Type
coiled coil region	89	120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167078
AA Change: I192T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132910
Gene: ENSMUSG00000034109
AA Change: I192T

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
coiled coil region	108	211	N/A	INTRINSIC
coiled coil region	295	326	N/A	INTRINSIC
coiled coil region	371	402	N/A	INTRINSIC
low complexity region	432	442	N/A	INTRINSIC
internal_repeat_1	472	524	2.99e-6	PROSPERO
low complexity region	538	550	N/A	INTRINSIC
internal_repeat_1	573	618	2.99e-6	PROSPERO
low complexity region	634	641	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi-resident protein. It may process proteins synthesized in the rough endoplasmic reticulum and assist in the transport of protein cargo through the Golgi apparatus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Golim4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Golim4	APN	3	75886311	missense	probably damaging	1.00
IGL01540:Golim4	APN	3	75886740	missense	possibly damaging	0.81
IGL01548:Golim4	APN	3	75908125	splice site	probably null
IGL01552:Golim4	APN	3	75956195	missense	probably damaging	1.00
IGL02218:Golim4	APN	3	75878054	missense	probably damaging	1.00
IGL02935:Golim4	APN	3	75894992	missense	possibly damaging	0.86
IGL03087:Golim4	APN	3	75878673	missense	possibly damaging	0.94
R1314:Golim4	UTSW	3	75886288	missense	probably damaging	1.00
R1436:Golim4	UTSW	3	75878644	critical splice donor site	probably null
R1438:Golim4	UTSW	3	75956133	missense	probably damaging	0.99
R1686:Golim4	UTSW	3	75895136	missense	probably benign	0.00
R1785:Golim4	UTSW	3	75908149	missense	probably damaging	1.00
R1786:Golim4	UTSW	3	75908149	missense	probably damaging	1.00
R1828:Golim4	UTSW	3	75902438	missense	probably damaging	1.00
R2057:Golim4	UTSW	3	75894887	missense	possibly damaging	0.62
R2130:Golim4	UTSW	3	75908149	missense	probably damaging	1.00
R2131:Golim4	UTSW	3	75908149	missense	probably damaging	1.00
R2133:Golim4	UTSW	3	75908149	missense	probably damaging	1.00
R2432:Golim4	UTSW	3	75891942	missense	possibly damaging	0.93
R2517:Golim4	UTSW	3	75892859	missense	probably benign	0.01
R3915:Golim4	UTSW	3	75903327	missense	probably damaging	1.00
R4414:Golim4	UTSW	3	75895040	missense	probably benign	0.00
R4976:Golim4	UTSW	3	75878643	splice site	probably null
R5619:Golim4	UTSW	3	75906495	nonsense	probably null
R7051:Golim4	UTSW	3	75893002	missense	probably benign	0.07
R7058:Golim4	UTSW	3	75878650	missense	probably damaging	1.00
R7303:Golim4	UTSW	3	75878053	missense	probably damaging	1.00
R7484:Golim4	UTSW	3	75898135	splice site	probably null
R7681:Golim4	UTSW	3	75887024	splice site	probably null
R7702:Golim4	UTSW	3	75886784	missense	probably damaging	1.00
R8354:Golim4	UTSW	3	75895001	missense	probably damaging	1.00
X0062:Golim4	UTSW	3	75906419	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGTGATGAGCTCGCAAAG -3'
(R):5'- CCCAATACTTTGCTGTTGAAGTTC -3'

Sequencing Primer
(F):5'- CAAGGACATTAGATTCCCTGGAGTTG -3'
(R):5'- GCTGTTGAAGTTCAAAATACACCTTG -3'

Posted On

2016-06-15