Incidental Mutation 'R5102:Rtkn'
ID392417
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Namerhotekin
Synonyms
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83135463-83152579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83149773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 305 (V305M)
Ref Sequence ENSEMBL: ENSMUSP00000112501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000125894] [ENSMUST00000129316] [ENSMUST00000130622] [ENSMUST00000135490] [ENSMUST00000153148]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032108
Predicted Effect probably damaging
Transcript: ENSMUST00000065512
AA Change: V318M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: V318M

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087938
AA Change: V305M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930
AA Change: V305M

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121093
AA Change: V305M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930
AA Change: V305M

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125894
SMART Domains Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129316
SMART Domains Protein: ENSMUSP00000120640
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130622
SMART Domains Protein: ENSMUSP00000122660
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 55 118 1.97e-12 SMART
Pfam:Anillin 135 217 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133226
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144723
Predicted Effect probably benign
Transcript: ENSMUST00000153148
SMART Domains Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
WD40 153 197 5.92e1 SMART
WD40 201 238 3.55e1 SMART
WD40 241 280 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154625
Predicted Effect probably benign
Transcript: ENSMUST00000213056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203183
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83146061 missense probably damaging 1.00
IGL02265:Rtkn APN 6 83147542 missense probably damaging 1.00
IGL02551:Rtkn APN 6 83151924 missense probably damaging 1.00
IGL03028:Rtkn APN 6 83147872 nonsense probably null
IGL03388:Rtkn APN 6 83150090 missense probably benign 0.02
R1648:Rtkn UTSW 6 83135994 missense probably damaging 1.00
R2100:Rtkn UTSW 6 83149560 splice site probably null
R2517:Rtkn UTSW 6 83147545 missense probably damaging 1.00
R3608:Rtkn UTSW 6 83150035 missense probably damaging 0.97
R3946:Rtkn UTSW 6 83135976 missense probably benign 0.01
R4170:Rtkn UTSW 6 83142395 start codon destroyed probably null
R4630:Rtkn UTSW 6 83152182 nonsense probably null
R5044:Rtkn UTSW 6 83150991 missense probably benign 0.01
R6165:Rtkn UTSW 6 83145963 missense probably damaging 1.00
R6372:Rtkn UTSW 6 83151901 missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83150012 missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83149711 missense probably damaging 0.99
R7251:Rtkn UTSW 6 83135962 missense probably damaging 1.00
R7381:Rtkn UTSW 6 83151745 missense probably damaging 0.97
R7598:Rtkn UTSW 6 83147903 missense probably null 0.96
R7624:Rtkn UTSW 6 83152177 missense probably benign
R8306:Rtkn UTSW 6 83151916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCCATCTTTCAGGGAC -3'
(R):5'- GCTGCGTAGACAACTTGGTG -3'

Sequencing Primer
(F):5'- CAGGGACACTGGCACTGGTAG -3'
(R):5'- CTGCGTAGACAACTTGGTGTTTTC -3'
Posted On2016-06-15