Incidental Mutation 'R0442:St3gal6'
ID39242
Institutional Source Beutler Lab
Gene Symbol St3gal6
Ensembl Gene ENSMUSG00000022747
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms1700023B24Rik, ST3Gal VI, Siat10
MMRRC Submission 038643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0442 (G1)
Quality Score164
Status Validated
Chromosome16
Chromosomal Location58468125-58524243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58473453 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 238 (A238S)
Ref Sequence ENSEMBL: ENSMUSP00000115756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663] [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]
Predicted Effect probably benign
Transcript: ENSMUST00000046663
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114357
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114358
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137035
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149197
Meta Mutation Damage Score 0.2020 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.4%
  • 20x: 81.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,396,470 N816Y probably damaging Het
Arfgef3 T C 10: 18,677,815 probably benign Het
Cd200 T A 16: 45,397,155 S58C probably damaging Het
Cep128 C T 12: 91,266,771 E508K probably damaging Het
Dnah2 C A 11: 69,448,542 L3046F probably damaging Het
Duox2 T C 2: 122,289,332 N872D probably benign Het
Fam90a1a C T 8: 21,963,058 T143I probably benign Het
Fdft1 T C 14: 63,163,349 T112A probably benign Het
Gimap9 G T 6: 48,678,066 G196* probably null Het
Grhl1 G A 12: 24,612,170 R536Q probably damaging Het
Gtpbp3 T A 8: 71,491,491 V293E probably damaging Het
Hcn3 A T 3: 89,151,540 F251Y probably damaging Het
Hectd4 T A 5: 121,323,982 C971S possibly damaging Het
Helz2 T A 2: 181,232,209 D2164V probably damaging Het
Hif1an T G 19: 44,566,012 L188R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqgap3 C T 3: 88,115,959 P519L probably damaging Het
Jakmip1 T G 5: 37,135,553 probably null Het
Klra1 T C 6: 130,372,872 Y201C probably damaging Het
Minpp1 T C 19: 32,493,948 F299L possibly damaging Het
Myb A G 10: 21,126,196 S749P probably benign Het
Myo3b T C 2: 70,238,961 probably null Het
Naip1 T A 13: 100,444,516 R74S probably benign Het
Nt5m A G 11: 59,874,619 T158A possibly damaging Het
Obscn A T 11: 59,002,174 probably benign Het
Olfr1475 T G 19: 13,480,048 D50A probably damaging Het
Olfr312 T A 11: 58,831,431 Y92* probably null Het
Olfr800 T C 10: 129,659,824 I6T probably benign Het
Otogl T A 10: 107,876,855 T543S probably damaging Het
Pds5b T C 5: 150,716,544 probably benign Het
Plekhm1 A G 11: 103,397,174 M49T possibly damaging Het
Rabl6 A T 2: 25,587,522 S305R probably damaging Het
Rad54b G A 4: 11,609,480 probably benign Het
Rad54b C A 4: 11,610,362 R660S probably benign Het
Rexo5 T C 7: 119,843,285 L542P probably damaging Het
Rp1 C T 1: 4,346,747 D1381N probably benign Het
Scnn1a T G 6: 125,339,137 M346R probably damaging Het
Sirpb1c A G 3: 15,802,546 I380T probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sstr3 A T 15: 78,540,397 L50Q probably damaging Het
Sun5 T C 2: 153,870,952 D16G possibly damaging Het
Svil A T 18: 5,046,870 T39S probably damaging Het
Taar1 A G 10: 23,920,482 Y26C possibly damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Use1 T C 8: 71,367,058 probably benign Het
Usp54 T C 14: 20,607,209 Y7C probably damaging Het
Zbtb37 A G 1: 161,032,348 F129S possibly damaging Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp28 T C 7: 6,394,999 L811P probably damaging Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Other mutations in St3gal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:St3gal6 APN 16 58484775 missense probably benign 0.31
IGL01583:St3gal6 APN 16 58493670 unclassified probably benign
IGL02512:St3gal6 APN 16 58473459 missense probably benign 0.00
R0212:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0212:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0441:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0441:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0442:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R1786:St3gal6 UTSW 16 58475871 missense probably damaging 1.00
R1939:St3gal6 UTSW 16 58473561 splice site probably null
R2233:St3gal6 UTSW 16 58473534 missense probably damaging 1.00
R2274:St3gal6 UTSW 16 58488969 missense possibly damaging 0.46
R2336:St3gal6 UTSW 16 58493704 missense probably damaging 1.00
R2434:St3gal6 UTSW 16 58470652 missense probably damaging 1.00
R3789:St3gal6 UTSW 16 58484773 missense probably benign 0.07
R6318:St3gal6 UTSW 16 58486406 missense probably benign 0.01
R7320:St3gal6 UTSW 16 58493711 missense probably benign 0.00
R7599:St3gal6 UTSW 16 58473437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCAACCTGTAAGACATGAGAGC -3'
(R):5'- TTCAGACTCCAGTCACTATGACCCC -3'

Sequencing Primer
(F):5'- GAGCATATCCATTTGGTGTCCAAC -3'
(R):5'- AATACTACAGCGGTTCTCGTCG -3'
Posted On2013-05-23