Incidental Mutation 'R5102:Cyth2'
ID392421
Institutional Source Beutler Lab
Gene Symbol Cyth2
Ensembl Gene ENSMUSG00000003269
Gene Namecytohesin 2
SynonymsARNO, CLM2, Pscd2
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45806637-45814581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45810702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 173 (S173P)
Ref Sequence ENSEMBL: ENSMUSP00000147706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056820] [ENSMUST00000107729] [ENSMUST00000209245] [ENSMUST00000210137] [ENSMUST00000210853] [ENSMUST00000210898] [ENSMUST00000211263] [ENSMUST00000211783]
Predicted Effect probably damaging
Transcript: ENSMUST00000056820
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051423
Gene: ENSMUSG00000003269
AA Change: S189P

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 378 3.07e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107726
AA Change: S173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103354
Gene: ENSMUSG00000003269
AA Change: S173P

DomainStartEndE-ValueType
Sec7 42 227 1.03e-102 SMART
PH 244 361 1.16e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107728
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103356
Gene: ENSMUSG00000003269
AA Change: S189P

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 388 3.07e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107729
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103357
Gene: ENSMUSG00000003269
AA Change: S189P

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 377 1.16e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129313
AA Change: V231A
Predicted Effect probably damaging
Transcript: ENSMUST00000139376
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119068
Gene: ENSMUSG00000003269
AA Change: S189P

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209245
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210137
Predicted Effect probably damaging
Transcript: ENSMUST00000210853
AA Change: S189P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210898
Predicted Effect probably benign
Transcript: ENSMUST00000211263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211394
Predicted Effect probably damaging
Transcript: ENSMUST00000211783
AA Change: S173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000223361
AA Change: S18P
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. The encoded protein exhibits GEP activity in vitro with ARF1, ARF3, and ARF6 and is 83% homologous to CYTH1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cell exhibit reduced sciatic nerve myelin sheath thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Cyth2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Cyth2 APN 7 45808389 missense probably damaging 1.00
IGL01957:Cyth2 APN 7 45808381 missense probably benign 0.00
FR4737:Cyth2 UTSW 7 45813042 missense possibly damaging 0.90
R0302:Cyth2 UTSW 7 45810585 nonsense probably null
R0600:Cyth2 UTSW 7 45813117 missense probably damaging 1.00
R4664:Cyth2 UTSW 7 45810719 missense probably damaging 1.00
R7532:Cyth2 UTSW 7 45808024 missense probably benign 0.20
R7846:Cyth2 UTSW 7 45810954 missense probably damaging 1.00
R7929:Cyth2 UTSW 7 45810954 missense probably damaging 1.00
Z1176:Cyth2 UTSW 7 45813105 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCCTGAGCGTACACATAGAC -3'
(R):5'- GGTCTTCCAGTCTACAGGTAGG -3'

Sequencing Primer
(F):5'- CCAACCAAGGGCTAGAGCAG -3'
(R):5'- TCTTCCAGTCTACAGGTAGGACCAG -3'
Posted On2016-06-15