Incidental Mutation 'R5102:Rab11fip1'
ID392428
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene NameRAB11 family interacting protein 1 (class I)
Synonyms4833414G05Rik, 2010200K21Rik
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27138773-27174646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27156374 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 225 (K225E)
Ref Sequence ENSEMBL: ENSMUSP00000147543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033878
AA Change: K225E

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488
AA Change: K225E

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054212
AA Change: K225E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: K225E

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209377
AA Change: K225E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211028
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27154776 missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27152797 missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27152812 missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27152760 missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0145:Rab11fip1 UTSW 8 27143324 missense probably damaging 1.00
R0243:Rab11fip1 UTSW 8 27152225 missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27154492 missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27143360 missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27154212 missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27153023 missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27152410 missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27152746 missense probably benign
R4157:Rab11fip1 UTSW 8 27152147 missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27154477 missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27154575 missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27154215 missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27152741 missense probably benign
R4834:Rab11fip1 UTSW 8 27153083 missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27154813 missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27151975 missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27156586 missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27154720 missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27156499 missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27174392 missense probably damaging 0.99
R6551:Rab11fip1 UTSW 8 27156484 missense probably damaging 0.96
R6695:Rab11fip1 UTSW 8 27143234 missense probably damaging 1.00
R6730:Rab11fip1 UTSW 8 27143229 missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27152732 frame shift probably null
R6925:Rab11fip1 UTSW 8 27152972 missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27156275 nonsense probably null
R7481:Rab11fip1 UTSW 8 27156581 missense probably damaging 1.00
R7504:Rab11fip1 UTSW 8 27152953 missense possibly damaging 0.78
R7610:Rab11fip1 UTSW 8 27152036 missense probably benign 0.19
R8264:Rab11fip1 UTSW 8 27152480 nonsense probably null
R8360:Rab11fip1 UTSW 8 27152346 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCCCTTCTCAGAGCACAG -3'
(R):5'- TCCATGAAAGACAAGTCCCGG -3'

Sequencing Primer
(F):5'- CTTCTCAGAGCACAGTCAGG -3'
(R):5'- AAGTCCCGGAATCCATTTGG -3'
Posted On2016-06-15