Incidental Mutation 'R5102:Gprin1'
ID392438
Institutional Source Beutler Lab
Gene Symbol Gprin1
Ensembl Gene ENSMUSG00000069227
Gene NameG protein-regulated inducer of neurite outgrowth 1
SynonymsGRIN1, Z16
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54736671-54749874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54739763 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 233 (M233V)
Ref Sequence ENSEMBL: ENSMUSP00000115539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145] [ENSMUST00000099506] [ENSMUST00000135343]
Predicted Effect probably benign
Transcript: ENSMUST00000037145
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099506
AA Change: M233V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097106
Gene: ENSMUSG00000069227
AA Change: M233V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 790 929 4.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135343
AA Change: M233V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115539
Gene: ENSMUSG00000069227
AA Change: M233V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 787 932 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Gprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Gprin1 APN 13 54740369 missense probably damaging 1.00
IGL02001:Gprin1 APN 13 54739192 missense probably damaging 1.00
IGL03188:Gprin1 APN 13 54738652 missense probably benign 0.02
IGL03308:Gprin1 APN 13 54740144 missense probably benign 0.05
R0980:Gprin1 UTSW 13 54740401 missense possibly damaging 0.75
R1638:Gprin1 UTSW 13 54739876 missense possibly damaging 0.53
R1942:Gprin1 UTSW 13 54739939 missense probably benign 0.36
R2145:Gprin1 UTSW 13 54738632 missense probably damaging 0.99
R2215:Gprin1 UTSW 13 54740233 missense probably damaging 0.99
R2338:Gprin1 UTSW 13 54738425 unclassified probably null
R3014:Gprin1 UTSW 13 54738475 missense probably benign 0.34
R4634:Gprin1 UTSW 13 54738058 missense probably damaging 1.00
R4732:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4733:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4903:Gprin1 UTSW 13 54737929 missense probably damaging 1.00
R4915:Gprin1 UTSW 13 54738073 missense probably damaging 1.00
R5979:Gprin1 UTSW 13 54739978 missense probably benign 0.01
R6544:Gprin1 UTSW 13 54740311 missense possibly damaging 0.46
R7007:Gprin1 UTSW 13 54738256 missense probably damaging 1.00
R7022:Gprin1 UTSW 13 54739042 missense probably benign 0.11
R7110:Gprin1 UTSW 13 54739243 missense probably benign 0.01
R7385:Gprin1 UTSW 13 54738610 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGAATTGCCCACAGCTGC -3'
(R):5'- ATTCTGGGTCCTTGGGAAAAGTAG -3'

Sequencing Primer
(F):5'- CACAGCTGCAGGACCTG -3'
(R):5'- TGCCATGTTCCAGCAAAGTG -3'
Posted On2016-06-15