Incidental Mutation 'R5102:Bmp4'
ID 392442
Institutional Source Beutler Lab
Gene Symbol Bmp4
Ensembl Gene ENSMUSG00000021835
Gene Name bone morphogenetic protein 4
Synonyms Bmp-4, Bmp2b-1, Bmp2b1, Bmp2b
MMRRC Submission 042690-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5102 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 46383520-46390669 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46384001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 362 (N362S)
Ref Sequence ENSEMBL: ENSMUSP00000098242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074077] [ENSMUST00000100676] [ENSMUST00000111826] [ENSMUST00000141358]
AlphaFold P21275
Predicted Effect probably damaging
Transcript: ENSMUST00000074077
AA Change: N362S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073720
Gene: ENSMUSG00000021835
AA Change: N362S

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 276 1.7e-77 PFAM
TGFB 308 408 4.53e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100676
AA Change: N362S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098242
Gene: ENSMUSG00000021835
AA Change: N362S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 39 276 3.7e-55 PFAM
TGFB 308 408 4.53e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135408
Predicted Effect probably benign
Transcript: ENSMUST00000141358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228667
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Homozygous knockout mice die in utero, while a conditional knockout mouse exhibits defects in heart development. Transgenic mice overexpressing this gene in a neuron-specific manner exhibit a phenotype resembling the rare hereditary connective tissue disease, fibrodysplasia ossificans progressiva. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted mutants have wide ranging effects, including embryonic lethality, aberrant mesoderm differentation, developmental retardation and disorganized posterior structures; heterozygous null mutants display anomalies of the kidney and urinary tract; other targeted mutants display failure of lens induction and lack primordial germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Bmp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Bmp4 APN 14 46384481 missense probably damaging 1.00
R0749:Bmp4 UTSW 14 46384613 missense probably damaging 0.99
R1052:Bmp4 UTSW 14 46383903 missense probably damaging 1.00
R3104:Bmp4 UTSW 14 46385981 missense probably benign 0.05
R3787:Bmp4 UTSW 14 46385714 critical splice donor site probably null
R3938:Bmp4 UTSW 14 46384079 missense probably damaging 1.00
R4768:Bmp4 UTSW 14 46385924 missense probably damaging 1.00
R5367:Bmp4 UTSW 14 46384493 missense possibly damaging 0.82
R5421:Bmp4 UTSW 14 46385898 missense probably damaging 0.98
R7189:Bmp4 UTSW 14 46383999 missense probably damaging 1.00
R8190:Bmp4 UTSW 14 46384515 missense probably benign
R8915:Bmp4 UTSW 14 46384445 missense probably damaging 1.00
Z1176:Bmp4 UTSW 14 46384628 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCAGCTATAGGGAAGCAGTTTG -3'
(R):5'- AAGAACTGCCGTCGCCATTC -3'

Sequencing Primer
(F):5'- AGCTATAGGGAAGCAGTTTGTGTGG -3'
(R):5'- CACTATACGTGGACTTCAGTGACG -3'
Posted On 2016-06-15