Mutagenetix > Incidental Mutations

Incidental Mutation 'R5102:Cdh10'

392444

Institutional Source

Beutler Lab

Gene Symbol

Cdh10

Ensembl Gene

ENSMUSG00000022321

Gene Name

cadherin 10

Synonyms

T2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik

MMRRC Submission

042690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18818947-19014236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18986885 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 401 (T401S)

Ref Sequence

ENSEMBL: ENSMUSP00000128782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]

Predicted Effect

probably benign
Transcript: ENSMUST00000040562
AA Change: T401S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: T401S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART
CA	406	487	6.23e-21	SMART
CA	510	594	3.56e-7	SMART
transmembrane domain	612	634	N/A	INTRINSIC
Pfam:Cadherin_C	635	782	9.2e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166873
AA Change: T401S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: T401S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART
CA	406	487	6.23e-21	SMART
CA	510	594	3.56e-7	SMART
transmembrane domain	612	634	N/A	INTRINSIC
Pfam:Cadherin_C	637	783	1.1e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176146
AA Change: T401S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321
AA Change: T401S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	77	158	2.8e-14	SMART
CA	182	267	1.03e-30	SMART
CA	291	383	6.04e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Cdh10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Cdh10	APN	15	19013263	missense	probably damaging	1.00
IGL00540:Cdh10	APN	15	18963995	missense	probably damaging	1.00
IGL00769:Cdh10	APN	15	18985099	missense	possibly damaging	0.63
IGL00837:Cdh10	APN	15	19013404	missense	probably benign
IGL01307:Cdh10	APN	15	18899800	missense	probably benign	0.34
IGL01509:Cdh10	APN	15	18986798	missense	possibly damaging	0.70
IGL01561:Cdh10	APN	15	18999926	missense	possibly damaging	0.52
IGL01743:Cdh10	APN	15	18986769	missense	probably benign	0.06
IGL02065:Cdh10	APN	15	19013256	missense	probably damaging	1.00
IGL02083:Cdh10	APN	15	18986889	missense	possibly damaging	0.79
IGL02238:Cdh10	APN	15	19013519	missense	probably damaging	1.00
IGL02838:Cdh10	APN	15	18899763	missense	probably damaging	1.00
IGL03397:Cdh10	APN	15	18964028	missense	probably damaging	1.00
R0423:Cdh10	UTSW	15	18986879	missense	probably benign	0.00
R0828:Cdh10	UTSW	15	18986751	missense	possibly damaging	0.52
R1488:Cdh10	UTSW	15	19013263	missense	probably damaging	1.00
R1563:Cdh10	UTSW	15	18986767	nonsense	probably null
R1674:Cdh10	UTSW	15	18985066	missense	probably benign	0.11
R1674:Cdh10	UTSW	15	19013330	missense	probably damaging	1.00
R1737:Cdh10	UTSW	15	18964063	missense	probably damaging	1.00
R1819:Cdh10	UTSW	15	18991965	nonsense	probably null
R1865:Cdh10	UTSW	15	18899604	missense	probably benign	0.01
R1953:Cdh10	UTSW	15	18966911	critical splice donor site	probably null
R2439:Cdh10	UTSW	15	19013398	missense	probably damaging	1.00
R3944:Cdh10	UTSW	15	18964249	missense	probably benign
R4320:Cdh10	UTSW	15	18985165	missense	probably benign	0.03
R4330:Cdh10	UTSW	15	18999959	missense	probably damaging	1.00
R4765:Cdh10	UTSW	15	19013278	missense	probably damaging	0.98
R4831:Cdh10	UTSW	15	19013578	missense	probably benign	0.10
R5166:Cdh10	UTSW	15	19013360	missense	probably damaging	0.99
R5217:Cdh10	UTSW	15	18966022	missense	probably damaging	0.98
R5843:Cdh10	UTSW	15	18985200	missense	possibly damaging	0.68
R5902:Cdh10	UTSW	15	18985255	critical splice donor site	probably null
R6263:Cdh10	UTSW	15	18964068	missense	possibly damaging	0.86
R6636:Cdh10	UTSW	15	18985173	missense	probably damaging	0.99
R6770:Cdh10	UTSW	15	18985222	missense	probably benign	0.09
R7046:Cdh10	UTSW	15	19013201	missense	probably damaging	0.98
R7362:Cdh10	UTSW	15	18899694	missense	probably benign
R7491:Cdh10	UTSW	15	19013359	missense	probably damaging	0.99
R7921:Cdh10	UTSW	15	18991956	missense	probably damaging	1.00
R7937:Cdh10	UTSW	15	18964249	missense	probably benign
R8685:Cdh10	UTSW	15	18899765	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCCACTTGACTATGAGAACCG -3'
(R):5'- GTGTTGCCCATGACACTCAATG -3'

Sequencing Primer
(F):5'- CCGAAGACTATATACTCTGAAGGTG -3'
(R):5'- TGTTGCCCATGACACTCAATGAAAAC -3'

Posted On

2016-06-15