Mutagenetix > Incidental Mutation

Incidental Mutation 'R5102:Mrpl2'

392446

Institutional Source

Beutler Lab

Gene Symbol

Mrpl2

Ensembl Gene

ENSMUSG00000002767

Gene Name

mitochondrial ribosomal protein L2

Synonyms

CGI-22, Rpml14, MRP-L14

MMRRC Submission

042690-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R5102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46646229-46650139 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46650038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 286 (R286Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002844] [ENSMUST00000003642] [ENSMUST00000043464] [ENSMUST00000113429] [ENSMUST00000113430] [ENSMUST00000133393] [ENSMUST00000145567]

AlphaFold

Q9D773

Predicted Effect

probably benign
Transcript: ENSMUST00000002844
AA Change: R288Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000002844
Gene: ENSMUSG00000002767
AA Change: R288Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Ribosomal_L2	84	166	3.44e-29	SMART
Ribosomal_L2_C	177	298	1.32e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000003642

SMART Domains

Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

Domain	Start	End	E-Value	Type
coiled coil region	90	155	N/A	INTRINSIC
low complexity region	194	204	N/A	INTRINSIC
Pfam:TPR_10	210	251	9.4e-9	PFAM
TPR	253	286	3.32e-1	SMART
TPR	295	328	7.16e-6	SMART
TPR	337	370	4.21e-3	SMART
TPR	379	412	9.03e-3	SMART
low complexity region	429	443	N/A	INTRINSIC
TPR	464	497	9.99e1	SMART
low complexity region	609	619	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000043464

SMART Domains

Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	218	229	N/A	INTRINSIC
low complexity region	315	324	N/A	INTRINSIC
Pfam:Cul7	349	423	5.7e-34	PFAM
low complexity region	462	476	N/A	INTRINSIC
low complexity region	603	618	N/A	INTRINSIC
low complexity region	635	648	N/A	INTRINSIC
APC10	811	973	9.35e-49	SMART
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1063	1074	N/A	INTRINSIC
low complexity region	1301	1318	N/A	INTRINSIC
low complexity region	1335	1370	N/A	INTRINSIC
Blast:Cullin_Nedd8	1550	1633	1e-41	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000113429

SMART Domains

Protein: ENSMUSP00000109056
Gene: ENSMUSG00000002767

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Ribosomal_L2	84	166	1.1e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113430
AA Change: R286Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000109057
Gene: ENSMUSG00000002767
AA Change: R286Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Ribosomal_L2	82	164	1.6e-31	PFAM
Pfam:Ribosomal_L2_C	175	279	5.6e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132790

Predicted Effect

probably benign
Transcript: ENSMUST00000133393

SMART Domains

Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

Domain	Start	End	E-Value	Type
low complexity region	17	26	N/A	INTRINSIC
Pfam:Cul7	51	126	8e-34	PFAM
low complexity region	164	178	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	337	350	N/A	INTRINSIC
SCOP:d1gqpa_	487	568	1e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144966

Predicted Effect

probably benign
Transcript: ENSMUST00000145567

SMART Domains

Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
SCOP:d1jdha_	63	222	2e-4	SMART
low complexity region	315	324	N/A	INTRINSIC
Pfam:Cul7	349	424	9.5e-34	PFAM
low complexity region	462	476	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146183

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156464

Meta Mutation Damage Score

0.0963

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL2 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 12q. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	A	G	5: 124,338,891	N83D	probably damaging	Het
Aox4	C	T	1: 58,240,778	R518C	probably damaging	Het
Apbb2	A	T	5: 66,312,249		probably null	Het
Arhgap45	C	T	10: 80,021,428	P254S	probably benign	Het
Arl4c	T	C	1: 88,701,600	D22G	probably damaging	Het
Asxl1	A	G	2: 153,400,955	T1142A	probably benign	Het
BC035044	T	C	6: 128,884,986		probably benign	Het
Bmp4	T	C	14: 46,384,001	N362S	probably damaging	Het
Cbll1	G	T	12: 31,487,913	T280N	probably damaging	Het
Cdh10	A	T	15: 18,986,885	T401S	probably benign	Het
Cps1	A	T	1: 67,206,793	M1148L	probably benign	Het
Crybg1	T	C	10: 43,997,836	D1092G	probably damaging	Het
Cyth2	A	G	7: 45,810,702	S173P	probably damaging	Het
D3Ertd254e	G	A	3: 36,162,665	C55Y	possibly damaging	Het
D6Ertd527e	A	T	6: 87,111,811	I319F	unknown	Het
Dchs1	A	T	7: 105,772,177	H345Q	probably benign	Het
Ddx50	A	T	10: 62,640,861	V211E	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Dnajb5	G	A	4: 42,956,639	D109N	possibly damaging	Het
Dner	A	T	1: 84,405,970	N564K	probably damaging	Het
Fam234b	T	C	6: 135,209,284	S97P	probably benign	Het
Fam53b	G	A	7: 132,715,955	R60*	probably null	Het
Fmo3	T	G	1: 162,963,977	K244Q	probably benign	Het
Gm12800	T	C	4: 101,909,239	F40S	probably damaging	Het
Golim4	A	G	3: 75,903,272	I192T	possibly damaging	Het
Gpr1	A	G	1: 63,183,167	V303A	probably damaging	Het
Gprin1	T	C	13: 54,739,763	M233V	probably benign	Het
Gtf2f1	A	T	17: 57,003,626	V443D	probably damaging	Het
H2afy	C	G	13: 56,096,123		probably null	Het
Hmgcs2	T	C	3: 98,280,470		probably benign	Het
Ide	T	A	19: 37,314,984	I271L	unknown	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif14	A	G	1: 136,516,403	I1378V	probably benign	Het
Lhx3	TCCTACGGGCCGGCCC	TCC	2: 26,201,423		probably null	Het
Lhx6	T	C	2: 36,094,210		probably null	Het
Lrp2	C	T	2: 69,489,158	G2007D	probably damaging	Het
Lrp5	T	C	19: 3,659,304	K142R	probably damaging	Het
Nacad	T	A	11: 6,598,528	D1402V	probably damaging	Het
Ndfip2	T	C	14: 105,298,105	I275T	possibly damaging	Het
Neb	A	C	2: 52,226,570	V4131G	possibly damaging	Het
Nfe2l1	G	A	11: 96,822,108	A83V	probably damaging	Het
Nos3	A	G	5: 24,371,627	D418G	probably damaging	Het
Olfr1126	A	T	2: 87,457,794	M210L	probably benign	Het
Olfr353	T	A	2: 36,890,044	K268M	possibly damaging	Het
Plcd4	A	G	1: 74,565,154	T764A	probably damaging	Het
Plppr3	G	T	10: 79,865,386	P541T	possibly damaging	Het
Polr2a	A	G	11: 69,746,945	I191T	possibly damaging	Het
Rab11fip1	T	C	8: 27,156,374	K225E	probably damaging	Het
Rara	A	T	11: 98,966,359	Q64L	possibly damaging	Het
Rtkn	G	A	6: 83,149,773	V305M	probably damaging	Het
Sh2b1	A	C	7: 126,471,236	F399V	probably benign	Het
Slc7a4	T	C	16: 17,575,618	T106A	probably damaging	Het
Srcap	G	A	7: 127,530,623	G539D	probably damaging	Het
Stab1	C	T	14: 31,148,017		probably null	Het

Other mutations in Mrpl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Mrpl2	APN	17	46649983	missense	probably damaging	1.00
IGL01757:Mrpl2	APN	17	46648257	missense	probably damaging	1.00
IGL02292:Mrpl2	APN	17	46648231	unclassified	probably benign
IGL03177:Mrpl2	APN	17	46649037	missense	probably damaging	0.99
IGL03326:Mrpl2	APN	17	46649927	missense	possibly damaging	0.78
R1620:Mrpl2	UTSW	17	46647499	missense	probably benign	0.28
R2567:Mrpl2	UTSW	17	46647501	missense	probably benign	0.17
R4573:Mrpl2	UTSW	17	46649041	missense	possibly damaging	0.89
R5103:Mrpl2	UTSW	17	46650038	missense	probably benign	0.11
R5283:Mrpl2	UTSW	17	46649066	missense	possibly damaging	0.83
R5405:Mrpl2	UTSW	17	46649110	critical splice donor site	probably null
R6199:Mrpl2	UTSW	17	46649086	missense	probably damaging	1.00
R6225:Mrpl2	UTSW	17	46649909	missense	probably damaging	0.98
R6232:Mrpl2	UTSW	17	46647430	missense	probably benign	0.01
R6841:Mrpl2	UTSW	17	46647456	missense	probably benign	0.31
R7170:Mrpl2	UTSW	17	46648255	missense	probably damaging	1.00
R7784:Mrpl2	UTSW	17	46648591	splice site	probably null
R7831:Mrpl2	UTSW	17	46648672	missense	possibly damaging	0.93
R8284:Mrpl2	UTSW	17	46647509	nonsense	probably null
R8938:Mrpl2	UTSW	17	46646312	unclassified	probably benign
R9510:Mrpl2	UTSW	17	46647514	missense	probably benign	0.19
X0018:Mrpl2	UTSW	17	46648351	missense	probably damaging	1.00
Z1088:Mrpl2	UTSW	17	46647478	missense	probably null	0.14

Predicted Primers

PCR Primer
(F):5'- TCACCCAGAGTAGTGTTCCC -3'
(R):5'- AGTGCCTTCCCATTTCCCAAAG -3'

Sequencing Primer
(F):5'- CCACCGGTGCGTTCTTG -3'
(R):5'- GGAGGTCATTTCTGCCCC -3'

Posted On

2016-06-15