Incidental Mutation 'R5103:Hacd1'
ID392456
Institutional Source Beutler Lab
Gene Symbol Hacd1
Ensembl Gene ENSMUSG00000063275
Gene Name3-hydroxyacyl-CoA dehydratase 1
SynonymsPtpla
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location13850282-14056135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14040913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000110401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074854] [ENSMUST00000091429] [ENSMUST00000114753] [ENSMUST00000131730]
Predicted Effect probably damaging
Transcript: ENSMUST00000074854
AA Change: T136A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074397
Gene: ENSMUSG00000063275
AA Change: T136A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 242 1.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091429
SMART Domains Protein: ENSMUSP00000088998
Gene: ENSMUSG00000063275

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114753
AA Change: T136A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110401
Gene: ENSMUSG00000063275
AA Change: T136A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:PTPLA 79 240 3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131730
SMART Domains Protein: ENSMUSP00000141406
Gene: ENSMUSG00000063275

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 79 144 5.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195416
Meta Mutation Damage Score 0.3725 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a characteristic catalytic motif of the protein tyrosine phosphatases (PTPs) family. The PTP motif of this protein has the highly conserved arginine residue replaced by a proline residue; thus it may represent a distinct class of PTPs. Members of the PTP family are known to be signaling molecules that regulate a variety of cellular processes. This gene was preferentially expressed in both adult and fetal heart. A much lower expression level was detected in skeletal and smooth muscle tissues, and no expression was observed in other tissues. The tissue specific expression in the developing and adult heart suggests a role in regulating cardiac development and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout leads to decreased body size and weight and reduced skeletal muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Hacd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01623:Hacd1 APN 2 14035856 missense probably benign 0.04
IGL01884:Hacd1 APN 2 14035782 missense probably damaging 1.00
IGL02214:Hacd1 APN 2 14026947 missense probably damaging 1.00
IGL02529:Hacd1 APN 2 14045202 missense probably damaging 1.00
R2340:Hacd1 UTSW 2 14035887 missense probably damaging 1.00
R3429:Hacd1 UTSW 2 14044775 splice site probably benign
R4946:Hacd1 UTSW 2 14045137 critical splice donor site probably null
R6468:Hacd1 UTSW 2 14035944 missense probably damaging 0.98
R6626:Hacd1 UTSW 2 14026944 missense probably benign 0.10
R6957:Hacd1 UTSW 2 14044853 missense probably damaging 1.00
R7643:Hacd1 UTSW 2 14044791 missense probably damaging 1.00
R7862:Hacd1 UTSW 2 14045202 missense probably damaging 1.00
R8146:Hacd1 UTSW 2 14044794 missense probably damaging 1.00
R8905:Hacd1 UTSW 2 14044950 missense possibly damaging 0.89
Z1176:Hacd1 UTSW 2 14035795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACCCAACTGTGATTGTCCC -3'
(R):5'- TATCAGTACGTAGTCAGCCCC -3'

Sequencing Primer
(F):5'- CGTGTTAGCTCAGCACACAAGG -3'
(R):5'- AACCATTATGTAGTGGTGACGTC -3'
Posted On2016-06-15