Incidental Mutation 'R5103:Golga2'
ID392458
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Namegolgi autoantigen, golgin subfamily a, 2
SynonymsGM130
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R5103 (G1)
Quality Score107
Status Validated
Chromosome2
Chromosomal Location32287384-32307921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32303746 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 458 (E458G)
Ref Sequence ENSEMBL: ENSMUSP00000080374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000081670] [ENSMUST00000091089] [ENSMUST00000100194] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000113377] [ENSMUST00000129156] [ENSMUST00000129193] [ENSMUST00000139624] [ENSMUST00000201433]
Predicted Effect probably benign
Transcript: ENSMUST00000078352
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081670
AA Change: E458G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546
AA Change: E458G

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091089
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100194
AA Change: E528G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546
AA Change: E528G

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113350
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113352
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113365
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113377
AA Change: E501G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546
AA Change: E501G

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect probably benign
Transcript: ENSMUST00000129156
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129193
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131712
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139624
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146544
Predicted Effect probably benign
Transcript: ENSMUST00000147707
SMART Domains Protein: ENSMUSP00000121886
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
coiled coil region 165 205 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149141
Predicted Effect probably benign
Transcript: ENSMUST00000201433
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
little UTSW 2 32305984 nonsense probably null
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 splice site probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1702:Golga2 UTSW 2 32299275 missense probably damaging 1.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1777:Golga2 UTSW 2 32305470 splice site probably null
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4783:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R5921:Golga2 UTSW 2 32297755 missense probably benign 0.00
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
R7365:Golga2 UTSW 2 32303001 nonsense probably null
R7390:Golga2 UTSW 2 32288190 missense
R7395:Golga2 UTSW 2 32305587 missense possibly damaging 0.94
R7555:Golga2 UTSW 2 32288166 missense probably benign 0.07
R7640:Golga2 UTSW 2 32306239 missense probably benign
R8219:Golga2 UTSW 2 32306480 missense probably damaging 1.00
R8554:Golga2 UTSW 2 32293345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCCTTTCTCAGAGGAGCCAC -3'
(R):5'- TCATGTGAGGTGGACAGCAC -3'

Sequencing Primer
(F):5'- AGCCACCGCCTCCAGAG -3'
(R):5'- TACATTCCCTGTGAGCAAGG -3'
Posted On2016-06-15