Mutagenetix > Incidental Mutation

Incidental Mutation 'R5103:Slc12a5'

392463

Institutional Source

Beutler Lab

Gene Symbol

Slc12a5

Ensembl Gene

ENSMUSG00000017740

Gene Name

solute carrier family 12, member 5

Synonyms

KCC2

MMRRC Submission

042691-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5103 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

164960802-164999731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 164992433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 791 (H791Q)

Ref Sequence

ENSEMBL: ENSMUSP00000144623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]

AlphaFold

Q91V14

Predicted Effect

probably damaging
Transcript: ENSMUST00000099092
AA Change: H768Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: H768Q

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	304	5.2e-22	PFAM
Pfam:AA_permease_2	364	632	1e-17	PFAM
Pfam:AA_permease	389	676	1.9e-42	PFAM
Pfam:SLC12	688	814	2.1e-19	PFAM
Pfam:SLC12	807	959	1.8e-20	PFAM
low complexity region	978	1002	N/A	INTRINSIC
Pfam:SLC12	1009	1115	2.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137302

Predicted Effect

probably benign
Transcript: ENSMUST00000202136

SMART Domains

Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	175	2.5e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202223
AA Change: H791Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: H791Q

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	1e-19	PFAM
Pfam:AA_permease_2	386	655	4.5e-15	PFAM
Pfam:AA_permease	412	699	3.7e-40	PFAM
Pfam:SLC12	711	837	7.2e-17	PFAM
Pfam:SLC12	830	982	6.2e-18	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1030	1133	8.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202479

SMART Domains

Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	176	5.2e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202623
AA Change: H791Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: H791Q

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	5.3e-22	PFAM
Pfam:AA_permease_2	386	655	1.2e-17	PFAM
Pfam:AA_permease	412	699	2e-42	PFAM
Pfam:SLC12	711	837	2.1e-19	PFAM
Pfam:SLC12	830	982	1.8e-20	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1032	1138	2.2e-15	PFAM

Meta Mutation Damage Score

0.2478

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,189,262	I591V	probably benign	Het
Agbl5	G	A	5: 30,894,001	R518H	probably damaging	Het
Agfg1	T	C	1: 82,893,567	S486P	probably damaging	Het
Arhgap18	A	G	10: 26,869,982	D283G	probably damaging	Het
Asb1	A	G	1: 91,552,344	N162S	possibly damaging	Het
BC037034	A	G	5: 138,262,300	V288A	probably benign	Het
Capn1	A	G	19: 6,009,110	Y274H	probably damaging	Het
Cdk5	A	T	5: 24,422,835	V30E	probably damaging	Het
Cep290	T	G	10: 100,539,020	L1376W	probably damaging	Het
Crybg1	T	A	10: 43,997,948	T1055S	probably damaging	Het
Cyp2c70	A	G	19: 40,160,632	Y357H	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Eml6	T	A	11: 29,850,905	E367V	possibly damaging	Het
Emp1	A	G	6: 135,381,075	T140A	probably benign	Het
Ergic3	T	C	2: 156,008,625	V74A	probably benign	Het
Fancm	A	T	12: 65,105,858	L1029F	probably damaging	Het
Fank1	C	A	7: 133,876,841	C210*	probably null	Het
Fbxo31	T	C	8: 121,552,362	D462G	probably damaging	Het
Frem1	G	A	4: 82,991,612	A736V	probably benign	Het
Fshr	T	C	17: 89,097,368	T56A	possibly damaging	Het
Gm5901	A	T	7: 105,377,382		probably null	Het
Gm8909	T	C	17: 36,161,685		probably benign	Het
Golga2	A	G	2: 32,303,746	E458G	probably benign	Het
Grik2	T	A	10: 49,496,109	I335F	probably benign	Het
Grin1	T	A	2: 25,310,421	M230L	probably benign	Het
Gtf2f1	C	T	17: 57,004,519	G297D	probably damaging	Het
Hacd1	T	C	2: 14,040,913	T136A	probably damaging	Het
Hdac5	T	A	11: 102,196,283	S24C	probably damaging	Het
Jtb	T	C	3: 90,232,087		probably benign	Het
Kif1a	C	T	1: 93,046,696	G979E	probably damaging	Het
Mark2	T	C	19: 7,284,503	M345V	probably damaging	Het
Mfsd14b	A	G	13: 65,087,093	V90A	possibly damaging	Het
Micu1	T	C	10: 59,788,984	Y283H	possibly damaging	Het
Mmp2	C	T	8: 92,831,785	R161*	probably null	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Msh5	T	C	17: 35,029,239	I783V	possibly damaging	Het
Myo3b	T	A	2: 70,096,403	F65I	probably benign	Het
Nat10	C	A	2: 103,757,260	V37L	probably damaging	Het
Nlrp1a	T	A	11: 71,099,526	T967S	probably damaging	Het
Nolc1	A	T	19: 46,081,664	K291*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr347	A	T	2: 36,734,668	T116S	probably benign	Het
Olfr52	C	A	2: 86,181,616	R165L	probably benign	Het
Olfr926	G	T	9: 38,877,576	M133I	probably damaging	Het
Paip1	A	G	13: 119,437,979	E70G	possibly damaging	Het
Palmd	T	A	3: 116,927,421	E127V	probably damaging	Het
Paqr6	T	A	3: 88,367,717	C262*	probably null	Het
Pdcd11	A	G	19: 47,124,454	H1301R	probably benign	Het
Plce1	C	A	19: 38,767,215	D1896E	probably damaging	Het
Ppib	A	G	9: 66,061,465		probably null	Het
Pzp	C	T	6: 128,502,229	V654M	probably benign	Het
Rab26	T	C	17: 24,534,097		probably benign	Het
Recql4	A	G	15: 76,706,756	L468P	probably damaging	Het
Retreg1	C	T	15: 25,968,454	Q65*	probably null	Het
Rhpn1	C	T	15: 75,714,215	T659I	possibly damaging	Het
Slc40a1	G	A	1: 45,918,995	Q93*	probably null	Het
Slc4a1	T	C	11: 102,353,261	M681V	possibly damaging	Het
Slc6a9	T	A	4: 117,868,155	F493L	probably benign	Het
Smc2	A	G	4: 52,459,033	E476G	probably damaging	Het
Smco4	G	T	9: 15,544,794	E59*	probably null	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Stat4	T	A	1: 52,071,895	L167Q	probably damaging	Het
Sult1e1	C	A	5: 87,576,232	V289L	probably benign	Het
Tbc1d4	C	A	14: 101,458,882	E877*	probably null	Het
Tenm4	A	T	7: 96,842,957	I1033F	probably damaging	Het
Tppp2	T	A	14: 51,919,452	F95L	probably benign	Het
Vmn2r41	G	A	7: 8,138,342	L708F	probably benign	Het
Washc5	G	A	15: 59,350,169	P126L	probably damaging	Het
Xkr4	T	C	1: 3,670,688	I221V	probably benign	Het
Xkr5	T	C	8: 18,933,643	R628G	probably benign	Het
Zfp207	T	C	11: 80,391,910	L233P	probably damaging	Het
Zfp827	T	A	8: 79,070,403	C373S	probably damaging	Het

Other mutations in Slc12a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Slc12a5	APN	2	164997121	missense	probably damaging	1.00
IGL00425:Slc12a5	APN	2	164983281	missense	probably damaging	1.00
IGL00976:Slc12a5	APN	2	164979304	missense	probably damaging	1.00
IGL01654:Slc12a5	APN	2	164973755	missense	possibly damaging	0.91
IGL01905:Slc12a5	APN	2	164990381	missense	probably benign	0.02
IGL02205:Slc12a5	APN	2	164996479	missense	probably benign	0.03
IGL02510:Slc12a5	APN	2	164982808	splice site	probably benign
IGL02746:Slc12a5	APN	2	164974916	missense	probably benign	0.01
G1Funyon:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98
R0051:Slc12a5	UTSW	2	164986663	missense	probably damaging	1.00
R0254:Slc12a5	UTSW	2	164997245	critical splice donor site	probably null
R0412:Slc12a5	UTSW	2	164994062	missense	probably benign	0.05
R0587:Slc12a5	UTSW	2	164976533	missense	probably damaging	1.00
R0835:Slc12a5	UTSW	2	164994038	missense	probably damaging	0.97
R0932:Slc12a5	UTSW	2	164996885	splice site	probably benign
R1643:Slc12a5	UTSW	2	164994027	missense	probably benign	0.01
R1700:Slc12a5	UTSW	2	164992376	missense	possibly damaging	0.94
R1760:Slc12a5	UTSW	2	164996128	missense	probably damaging	0.99
R2063:Slc12a5	UTSW	2	164997147	missense	probably damaging	1.00
R2293:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R2412:Slc12a5	UTSW	2	164976462	critical splice donor site	probably null
R3035:Slc12a5	UTSW	2	164980258	missense	probably benign	0.06
R3116:Slc12a5	UTSW	2	164996181	splice site	probably null
R3412:Slc12a5	UTSW	2	164968431	missense	probably benign	0.26
R3788:Slc12a5	UTSW	2	164993775	missense	probably damaging	1.00
R4039:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R4174:Slc12a5	UTSW	2	164979490	missense	probably damaging	1.00
R4492:Slc12a5	UTSW	2	164979343	missense	probably benign	0.08
R4608:Slc12a5	UTSW	2	164973765	missense	probably damaging	0.99
R4750:Slc12a5	UTSW	2	164982931	missense	probably benign	0.06
R4994:Slc12a5	UTSW	2	164983365	splice site	probably null
R5539:Slc12a5	UTSW	2	164987206	missense	possibly damaging	0.94
R5632:Slc12a5	UTSW	2	164987221	missense	possibly damaging	0.86
R5771:Slc12a5	UTSW	2	164973768	missense	possibly damaging	0.88
R6139:Slc12a5	UTSW	2	164992311	missense	probably damaging	0.98
R6336:Slc12a5	UTSW	2	164992464	splice site	probably null
R6581:Slc12a5	UTSW	2	164987115	missense	probably damaging	1.00
R6706:Slc12a5	UTSW	2	164988589	missense	probably damaging	1.00
R6886:Slc12a5	UTSW	2	164982905	missense	probably benign
R7134:Slc12a5	UTSW	2	164974958	missense	probably damaging	1.00
R7310:Slc12a5	UTSW	2	164992440	missense	probably damaging	1.00
R7402:Slc12a5	UTSW	2	164982932	missense	probably benign	0.01
R8079:Slc12a5	UTSW	2	164992452	missense	probably damaging	1.00
R8301:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98
R9105:Slc12a5	UTSW	2	164996194	missense	probably benign
R9132:Slc12a5	UTSW	2	164993956	intron	probably benign
R9431:Slc12a5	UTSW	2	164990258	missense	possibly damaging	0.95
R9580:Slc12a5	UTSW	2	164974976	missense	probably damaging	0.99
R9677:Slc12a5	UTSW	2	164992326	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- AGGGAGTCTGTGAGCCCAAG -3'
(R):5'- CAGAAGCTGGCATGTGGTGTC -3'

Sequencing Primer
(F):5'- TGTGAGCCCAAGCCCCAG -3'
(R):5'- TATGTGCTGAGACTCGCAC -3'

Posted On

2016-06-15