Incidental Mutation 'R5103:Cdk5'
ID392472
Institutional Source Beutler Lab
Gene Symbol Cdk5
Ensembl Gene ENSMUSG00000028969
Gene Namecyclin-dependent kinase 5
SynonymsCrk6
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24418241-24423530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24422835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 30 (V30E)
Ref Sequence ENSEMBL: ENSMUSP00000030814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000080067] [ENSMUST00000141966] [ENSMUST00000153274] [ENSMUST00000155598] [ENSMUST00000198990]
Predicted Effect probably damaging
Transcript: ENSMUST00000030814
AA Change: V30E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969
AA Change: V30E

DomainStartEndE-ValueType
S_TKc 4 286 6.11e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139081
Predicted Effect probably benign
Transcript: ENSMUST00000141966
SMART Domains Protein: ENSMUSP00000117215
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144305
Predicted Effect probably benign
Transcript: ENSMUST00000153274
Predicted Effect probably benign
Transcript: ENSMUST00000155598
SMART Domains Protein: ENSMUSP00000118473
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197619
Predicted Effect probably benign
Transcript: ENSMUST00000198442
Predicted Effect probably damaging
Transcript: ENSMUST00000198990
AA Change: V30E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142413
Gene: ENSMUSG00000028969
AA Change: V30E

DomainStartEndE-ValueType
Pfam:Pkinase 4 101 9.7e-23 PFAM
Pfam:Pkinase_Tyr 4 102 2.7e-13 PFAM
Pfam:Pkinase 97 254 6.6e-30 PFAM
Pfam:Pkinase_Tyr 102 200 9.4e-6 PFAM
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality and abnormalities of the cerebellum and nervous system. Mutant mice are cyanotic, hypoactive, exhibit shallow breathing, and fail to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Cdk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Cdk5 APN 5 24419595 splice site probably null
IGL02147:Cdk5 APN 5 24420320 missense probably benign 0.01
IGL02395:Cdk5 APN 5 24419637 missense possibly damaging 0.79
IGL02557:Cdk5 APN 5 24419653 missense probably benign 0.00
R4503:Cdk5 UTSW 5 24419619 missense possibly damaging 0.75
R5215:Cdk5 UTSW 5 24419461 missense probably benign 0.24
R7972:Cdk5 UTSW 5 24419658 missense probably benign
R8057:Cdk5 UTSW 5 24420784 missense probably damaging 1.00
R8923:Cdk5 UTSW 5 24420286 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAGGAGGTTCTATCCTACCTGAC -3'
(R):5'- ATTCTCCCTGCAGCTGAAGC -3'

Sequencing Primer
(F):5'- TCTATCCTACCTGACAATGTTTTTG -3'
(R):5'- TGCAGCTGAAGCCTTGAG -3'
Posted On2016-06-15