Incidental Mutation 'R5103:Micu1'
ID392496
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Namemitochondrial calcium uptake 1
SynonymsC730016L05Rik, Cbara1
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59702477-59864132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59788984 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 283 (Y283H)
Ref Sequence ENSEMBL: ENSMUSP00000136567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000171409] [ENSMUST00000179709]
Predicted Effect probably benign
Transcript: ENSMUST00000020311
AA Change: Y289H

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: Y289H

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092508
AA Change: Y287H

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: Y287H

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165563
AA Change: Y283H

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171409
SMART Domains Protein: ENSMUSP00000131000
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 61 N/A INTRINSIC
Pfam:EF-hand_6 191 221 1.8e-6 PFAM
Pfam:EF-hand_5 192 216 5.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172034
Predicted Effect possibly damaging
Transcript: ENSMUST00000179709
AA Change: Y283H

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Meta Mutation Damage Score 0.4830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59863278 missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59839736 missense probably damaging 1.00
IGL03183:Micu1 APN 10 59728048 nonsense probably null
R0025:Micu1 UTSW 10 59788877 critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59839681 missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59756727 intron probably benign
R1121:Micu1 UTSW 10 59788982 missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59788976 missense probably damaging 1.00
R1762:Micu1 UTSW 10 59863260 missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59733161 splice site probably benign
R1976:Micu1 UTSW 10 59768213 missense probably damaging 1.00
R2082:Micu1 UTSW 10 59863307 missense probably benign 0.00
R2152:Micu1 UTSW 10 59863288 missense probably benign 0.01
R2395:Micu1 UTSW 10 59863202 nonsense probably null
R3619:Micu1 UTSW 10 59768258 splice site probably null
R3953:Micu1 UTSW 10 59750504 missense probably benign 0.01
R4809:Micu1 UTSW 10 59740822 missense probably benign
R4948:Micu1 UTSW 10 59863254 missense possibly damaging 0.56
R5137:Micu1 UTSW 10 59827232 missense probably benign 0.20
R5431:Micu1 UTSW 10 59750521 missense possibly damaging 0.92
R5805:Micu1 UTSW 10 59827306 missense possibly damaging 0.46
R6910:Micu1 UTSW 10 59740667 missense probably damaging 1.00
R7030:Micu1 UTSW 10 59789021 missense possibly damaging 0.92
R7845:Micu1 UTSW 10 59839785 critical splice donor site probably null
Z1177:Micu1 UTSW 10 59728041 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTAGGGGTAGCCTTTCC -3'
(R):5'- TCCTGGTTTACGGATCAACC -3'

Sequencing Primer
(F):5'- CTGTGTCTCACCATCCTGAGTCTAAG -3'
(R):5'- CTGGTTTACGGATCAACCACAAGG -3'
Posted On2016-06-15