Mutagenetix > Incidental Mutation

Incidental Mutation 'R5103:Cep290'

392497

Institutional Source

Beutler Lab

Gene Symbol

Cep290

Ensembl Gene

ENSMUSG00000019971

Gene Name

centrosomal protein 290

Synonyms

b2b1454Clo, Nphp6, b2b1752Clo

MMRRC Submission

042691-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R5103 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100487558-100574840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 100539020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Tryptophan at position 1376 (L1376W)

Ref Sequence

ENSEMBL: ENSMUSP00000151388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]

AlphaFold

Q6A078

Predicted Effect

probably damaging
Transcript: ENSMUST00000164751
AA Change: L1376W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: L1376W

Domain	Start	End	E-Value	Type
coiled coil region	59	298	N/A	INTRINSIC
coiled coil region	319	566	N/A	INTRINSIC
coiled coil region	598	662	N/A	INTRINSIC
coiled coil region	697	754	N/A	INTRINSIC
coiled coil region	780	875	N/A	INTRINSIC
internal_repeat_2	884	894	1.1e-5	PROSPERO
coiled coil region	986	1028	N/A	INTRINSIC
internal_repeat_2	1057	1067	1.1e-5	PROSPERO
coiled coil region	1071	1109	N/A	INTRINSIC
low complexity region	1140	1156	N/A	INTRINSIC
internal_repeat_1	1176	1206	8.72e-8	PROSPERO
coiled coil region	1221	1250	N/A	INTRINSIC
Pfam:CEP209_CC5	1290	1417	3.8e-55	PFAM
low complexity region	1476	1493	N/A	INTRINSIC
internal_repeat_1	1498	1525	8.72e-8	PROSPERO
coiled coil region	1535	1595	N/A	INTRINSIC
coiled coil region	1624	1716	N/A	INTRINSIC
coiled coil region	1776	2328	N/A	INTRINSIC
low complexity region	2333	2347	N/A	INTRINSIC
coiled coil region	2377	2453	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218703

Predicted Effect

probably benign
Transcript: ENSMUST00000219408

Predicted Effect

probably damaging
Transcript: ENSMUST00000219765
AA Change: L1369W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220346
AA Change: L1376W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.0981

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,189,262	I591V	probably benign	Het
Agbl5	G	A	5: 30,894,001	R518H	probably damaging	Het
Agfg1	T	C	1: 82,893,567	S486P	probably damaging	Het
Arhgap18	A	G	10: 26,869,982	D283G	probably damaging	Het
Asb1	A	G	1: 91,552,344	N162S	possibly damaging	Het
BC037034	A	G	5: 138,262,300	V288A	probably benign	Het
Capn1	A	G	19: 6,009,110	Y274H	probably damaging	Het
Cdk5	A	T	5: 24,422,835	V30E	probably damaging	Het
Crybg1	T	A	10: 43,997,948	T1055S	probably damaging	Het
Cyp2c70	A	G	19: 40,160,632	Y357H	probably damaging	Het
Dlx6	AGG	AG	6: 6,865,180		probably null	Het
Eml6	T	A	11: 29,850,905	E367V	possibly damaging	Het
Emp1	A	G	6: 135,381,075	T140A	probably benign	Het
Ergic3	T	C	2: 156,008,625	V74A	probably benign	Het
Fancm	A	T	12: 65,105,858	L1029F	probably damaging	Het
Fank1	C	A	7: 133,876,841	C210*	probably null	Het
Fbxo31	T	C	8: 121,552,362	D462G	probably damaging	Het
Frem1	G	A	4: 82,991,612	A736V	probably benign	Het
Fshr	T	C	17: 89,097,368	T56A	possibly damaging	Het
Gm5901	A	T	7: 105,377,382		probably null	Het
Gm8909	T	C	17: 36,161,685		probably benign	Het
Golga2	A	G	2: 32,303,746	E458G	probably benign	Het
Grik2	T	A	10: 49,496,109	I335F	probably benign	Het
Grin1	T	A	2: 25,310,421	M230L	probably benign	Het
Gtf2f1	C	T	17: 57,004,519	G297D	probably damaging	Het
Hacd1	T	C	2: 14,040,913	T136A	probably damaging	Het
Hdac5	T	A	11: 102,196,283	S24C	probably damaging	Het
Jtb	T	C	3: 90,232,087		probably benign	Het
Kif1a	C	T	1: 93,046,696	G979E	probably damaging	Het
Mark2	T	C	19: 7,284,503	M345V	probably damaging	Het
Mfsd14b	A	G	13: 65,087,093	V90A	possibly damaging	Het
Micu1	T	C	10: 59,788,984	Y283H	possibly damaging	Het
Mmp2	C	T	8: 92,831,785	R161*	probably null	Het
Mrpl2	G	A	17: 46,650,038	R286Q	probably benign	Het
Msh5	T	C	17: 35,029,239	I783V	possibly damaging	Het
Myo3b	T	A	2: 70,096,403	F65I	probably benign	Het
Nat10	C	A	2: 103,757,260	V37L	probably damaging	Het
Nlrp1a	T	A	11: 71,099,526	T967S	probably damaging	Het
Nolc1	A	T	19: 46,081,664	K291*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr347	A	T	2: 36,734,668	T116S	probably benign	Het
Olfr52	C	A	2: 86,181,616	R165L	probably benign	Het
Olfr926	G	T	9: 38,877,576	M133I	probably damaging	Het
Paip1	A	G	13: 119,437,979	E70G	possibly damaging	Het
Palmd	T	A	3: 116,927,421	E127V	probably damaging	Het
Paqr6	T	A	3: 88,367,717	C262*	probably null	Het
Pdcd11	A	G	19: 47,124,454	H1301R	probably benign	Het
Plce1	C	A	19: 38,767,215	D1896E	probably damaging	Het
Ppib	A	G	9: 66,061,465		probably null	Het
Pzp	C	T	6: 128,502,229	V654M	probably benign	Het
Rab26	T	C	17: 24,534,097		probably benign	Het
Recql4	A	G	15: 76,706,756	L468P	probably damaging	Het
Retreg1	C	T	15: 25,968,454	Q65*	probably null	Het
Rhpn1	C	T	15: 75,714,215	T659I	possibly damaging	Het
Slc12a5	C	A	2: 164,992,433	H791Q	probably damaging	Het
Slc40a1	G	A	1: 45,918,995	Q93*	probably null	Het
Slc4a1	T	C	11: 102,353,261	M681V	possibly damaging	Het
Slc6a9	T	A	4: 117,868,155	F493L	probably benign	Het
Smc2	A	G	4: 52,459,033	E476G	probably damaging	Het
Smco4	G	T	9: 15,544,794	E59*	probably null	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Stat4	T	A	1: 52,071,895	L167Q	probably damaging	Het
Sult1e1	C	A	5: 87,576,232	V289L	probably benign	Het
Tbc1d4	C	A	14: 101,458,882	E877*	probably null	Het
Tenm4	A	T	7: 96,842,957	I1033F	probably damaging	Het
Tppp2	T	A	14: 51,919,452	F95L	probably benign	Het
Vmn2r41	G	A	7: 8,138,342	L708F	probably benign	Het
Washc5	G	A	15: 59,350,169	P126L	probably damaging	Het
Xkr4	T	C	1: 3,670,688	I221V	probably benign	Het
Xkr5	T	C	8: 18,933,643	R628G	probably benign	Het
Zfp207	T	C	11: 80,391,910	L233P	probably damaging	Het
Zfp827	T	A	8: 79,070,403	C373S	probably damaging	Het

Other mutations in Cep290

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Cep290	APN	10	100508724	missense	probably benign	0.00
IGL00499:Cep290	APN	10	100543327	missense	probably damaging	1.00
IGL00547:Cep290	APN	10	100510708	missense	probably damaging	0.99
IGL00573:Cep290	APN	10	100540361	missense	probably damaging	1.00
IGL00646:Cep290	APN	10	100501154	missense	probably benign	0.15
IGL00755:Cep290	APN	10	100531104	missense	probably damaging	1.00
IGL00835:Cep290	APN	10	100563380	nonsense	probably null
IGL00846:Cep290	APN	10	100540333	splice site	probably benign
IGL00985:Cep290	APN	10	100567161	splice site	probably benign
IGL01687:Cep290	APN	10	100500205	missense	probably damaging	1.00
IGL01782:Cep290	APN	10	100545125	nonsense	probably null
IGL02010:Cep290	APN	10	100508707	missense	probably benign	0.39
IGL02010:Cep290	APN	10	100561345	missense	probably benign	0.00
IGL02036:Cep290	APN	10	100558100	nonsense	probably null
IGL02039:Cep290	APN	10	100514602	critical splice donor site	probably null
IGL02532:Cep290	APN	10	100545065	missense	probably benign	0.04
IGL02950:Cep290	APN	10	100540329	splice site	probably benign
IGL03105:Cep290	APN	10	100551824	missense	possibly damaging	0.66
IGL03179:Cep290	APN	10	100568088	missense	possibly damaging	0.60
IGL03271:Cep290	APN	10	100537801	missense	probably benign	0.09
IGL03401:Cep290	APN	10	100500265	missense	probably benign	0.27
PIT4687001:Cep290	UTSW	10	100537591	missense	probably benign	0.28
R0025:Cep290	UTSW	10	100537831	missense	probably damaging	1.00
R0127:Cep290	UTSW	10	100536925	splice site	probably benign
R0254:Cep290	UTSW	10	100514574	missense	probably benign	0.31
R0295:Cep290	UTSW	10	100537821	missense	probably damaging	0.99
R0371:Cep290	UTSW	10	100518564	splice site	probably benign
R0390:Cep290	UTSW	10	100508758	missense	probably benign	0.09
R0399:Cep290	UTSW	10	100554400	splice site	probably benign
R0413:Cep290	UTSW	10	100523314	nonsense	probably null
R0427:Cep290	UTSW	10	100516179	missense	probably benign	0.01
R0472:Cep290	UTSW	10	100551455	missense	probably benign	0.19
R0485:Cep290	UTSW	10	100549344	missense	possibly damaging	0.94
R0635:Cep290	UTSW	10	100492676	missense	probably damaging	1.00
R0675:Cep290	UTSW	10	100568813	critical splice acceptor site	probably null
R0972:Cep290	UTSW	10	100518762	missense	probably benign	0.08
R1238:Cep290	UTSW	10	100517863	missense	probably damaging	1.00
R1297:Cep290	UTSW	10	100539100	splice site	probably benign
R1368:Cep290	UTSW	10	100494966	splice site	probably benign
R1394:Cep290	UTSW	10	100537529	missense	possibly damaging	0.66
R1437:Cep290	UTSW	10	100572101	missense	probably benign	0.00
R1493:Cep290	UTSW	10	100562181	missense	probably benign	0.21
R1496:Cep290	UTSW	10	100538966	missense	probably damaging	1.00
R1539:Cep290	UTSW	10	100496828	missense	probably benign	0.06
R1598:Cep290	UTSW	10	100549329	missense	probably damaging	1.00
R1616:Cep290	UTSW	10	100568836	missense	probably benign
R1712:Cep290	UTSW	10	100554499	missense	probably benign	0.02
R1753:Cep290	UTSW	10	100513981	missense	probably benign
R1773:Cep290	UTSW	10	100510573	missense	probably benign
R1775:Cep290	UTSW	10	100496810	missense	probably damaging	0.98
R1799:Cep290	UTSW	10	100516196	missense	probably benign	0.00
R1937:Cep290	UTSW	10	100497953	missense	possibly damaging	0.71
R1991:Cep290	UTSW	10	100531184	missense	possibly damaging	0.80
R2031:Cep290	UTSW	10	100512400	critical splice donor site	probably null
R2164:Cep290	UTSW	10	100518795	missense	probably damaging	0.96
R2393:Cep290	UTSW	10	100561238	critical splice acceptor site	probably null
R2403:Cep290	UTSW	10	100537437	missense	probably benign	0.19
R3612:Cep290	UTSW	10	100541581	nonsense	probably null
R3800:Cep290	UTSW	10	100572941	missense	probably damaging	0.97
R4005:Cep290	UTSW	10	100539008	missense	probably damaging	1.00
R4039:Cep290	UTSW	10	100512401	critical splice donor site	probably null
R4259:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4260:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4319:Cep290	UTSW	10	100539047	missense	probably benign	0.09
R4329:Cep290	UTSW	10	100537668	missense	probably damaging	0.98
R4573:Cep290	UTSW	10	100518850	missense	probably benign
R4614:Cep290	UTSW	10	100508740	missense	probably benign
R4614:Cep290	UTSW	10	100559687	missense	possibly damaging	0.93
R4708:Cep290	UTSW	10	100523264	missense	probably benign	0.02
R4727:Cep290	UTSW	10	100563270	missense	probably benign	0.05
R4825:Cep290	UTSW	10	100488348	missense	probably damaging	0.96
R4839:Cep290	UTSW	10	100508786	missense	probably damaging	0.99
R4858:Cep290	UTSW	10	100494911	missense	probably benign	0.31
R4871:Cep290	UTSW	10	100548914	missense	probably benign	0.22
R5094:Cep290	UTSW	10	100567030	missense	probably damaging	0.97
R5499:Cep290	UTSW	10	100537653	missense	probably damaging	0.99
R5505:Cep290	UTSW	10	100499186	critical splice donor site	probably null
R5615:Cep290	UTSW	10	100531150	missense	probably damaging	1.00
R5815:Cep290	UTSW	10	100558108	missense	possibly damaging	0.80
R5883:Cep290	UTSW	10	100523399	missense	probably benign	0.44
R5889:Cep290	UTSW	10	100499074	missense	possibly damaging	0.95
R5928:Cep290	UTSW	10	100551830	missense	probably damaging	0.99
R5992:Cep290	UTSW	10	100543321	missense	possibly damaging	0.73
R6000:Cep290	UTSW	10	100541787	missense	probably damaging	1.00
R6213:Cep290	UTSW	10	100523360	missense	probably benign	0.06
R6274:Cep290	UTSW	10	100530207	missense	probably damaging	1.00
R6285:Cep290	UTSW	10	100523329	missense	probably benign	0.17
R6306:Cep290	UTSW	10	100531166	missense	possibly damaging	0.89
R6593:Cep290	UTSW	10	100508776	missense	probably benign	0.01
R6649:Cep290	UTSW	10	100518531	missense	probably benign	0.28
R6692:Cep290	UTSW	10	100569144	splice site	probably null
R6788:Cep290	UTSW	10	100488628	missense	probably damaging	1.00
R6847:Cep290	UTSW	10	100563419	missense	probably damaging	1.00
R6947:Cep290	UTSW	10	100530056	missense	probably damaging	1.00
R7035:Cep290	UTSW	10	100499071	missense	probably benign	0.07
R7073:Cep290	UTSW	10	100539003	missense	possibly damaging	0.90
R7114:Cep290	UTSW	10	100543358	missense	probably damaging	0.98
R7256:Cep290	UTSW	10	100546498	missense	probably damaging	1.00
R7258:Cep290	UTSW	10	100499108	missense	probably benign	0.01
R7311:Cep290	UTSW	10	100537718	missense	probably damaging	0.98
R7505:Cep290	UTSW	10	100516265	missense	probably benign	0.01
R7615:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7643:Cep290	UTSW	10	100537553	missense	probably benign
R7662:Cep290	UTSW	10	100537803	missense	probably benign	0.21
R7663:Cep290	UTSW	10	100554536	critical splice donor site	probably null
R7685:Cep290	UTSW	10	100540057	missense	probably benign	0.19
R7699:Cep290	UTSW	10	100540369	missense	probably benign	0.33
R7717:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7747:Cep290	UTSW	10	100558176	nonsense	probably null
R7757:Cep290	UTSW	10	100563434	missense	probably benign
R7843:Cep290	UTSW	10	100516188	missense	possibly damaging	0.49
R7905:Cep290	UTSW	10	100554490	missense	probably benign
R8078:Cep290	UTSW	10	100572887	missense	probably benign	0.04
R8081:Cep290	UTSW	10	100558176	nonsense	probably null
R8094:Cep290	UTSW	10	100544931	missense	possibly damaging	0.95
R8266:Cep290	UTSW	10	100559671	missense	probably benign	0.08
R8305:Cep290	UTSW	10	100544934	missense	probably benign	0.09
R8325:Cep290	UTSW	10	100517808	missense	probably benign	0.03
R8372:Cep290	UTSW	10	100549341	missense	probably benign	0.00
R8443:Cep290	UTSW	10	100495844	missense	possibly damaging	0.80
R8497:Cep290	UTSW	10	100551458	missense	probably damaging	1.00
R8778:Cep290	UTSW	10	100514512	nonsense	probably null
R8975:Cep290	UTSW	10	100513920	missense	possibly damaging	0.54
R9146:Cep290	UTSW	10	100541803	missense	probably benign	0.44
R9264:Cep290	UTSW	10	100498016	missense	possibly damaging	0.86
R9374:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9448:Cep290	UTSW	10	100559684	missense	probably benign	0.32
R9499:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9507:Cep290	UTSW	10	100494923	missense	possibly damaging	0.81
R9539:Cep290	UTSW	10	100568851	missense	probably damaging	1.00
R9547:Cep290	UTSW	10	100544979	missense	probably benign	0.00
R9551:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9657:Cep290	UTSW	10	100515141	missense	possibly damaging	0.93
R9731:Cep290	UTSW	10	100510542	missense	probably damaging	0.98
R9756:Cep290	UTSW	10	100516172	missense	probably damaging	0.97
R9777:Cep290	UTSW	10	100518667	missense	probably benign	0.01
Z1176:Cep290	UTSW	10	100549374	critical splice donor site	probably benign
Z1177:Cep290	UTSW	10	100497944	missense	probably benign
Z1177:Cep290	UTSW	10	100538997	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCAAATGTTACTAGGCTATTCATTTCG -3'
(R):5'- TGTGTTCTAAATCAGCACTGACATCC -3'

Sequencing Primer
(F):5'- GCTTTGCCATTAATTTCGAT -3'
(R):5'- GCATGTTTGGGAATTTAAAAAGCAAG -3'

Posted On

2016-06-15