Incidental Mutation 'R5103:Slc4a1'
ID392502
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Namesolute carrier family 4 (anion exchanger), member 1
SynonymsAe1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
MMRRC Submission 042691-MU
Accession Numbers

Genbank: NM_011403; MGI: 109393

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102348824-102366203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102353261 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 681 (M681V)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006749
AA Change: M681V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: M681V

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Meta Mutation Damage Score 0.3833 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102357964 missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102353903 missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102354333 missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102356267 missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102359146 critical splice acceptor site probably null
Rumor UTSW 11 102361222 nonsense probably null
A5278:Slc4a1 UTSW 11 102353815 splice site probably benign
R0011:Slc4a1 UTSW 11 102357110 missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102352684 missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102354366 missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102357915 splice site probably benign
R0635:Slc4a1 UTSW 11 102352672 missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102361171 missense probably benign
R1816:Slc4a1 UTSW 11 102351230 missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102350307 missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102356830 missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102359302 missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102357193 missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102356258 missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102351503 missense probably benign 0.12
R5234:Slc4a1 UTSW 11 102361383 missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102359077 missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102358254 missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102350314 missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102353266 missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102356525 missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102352531 missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102356735 missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102361222 nonsense probably null
R6717:Slc4a1 UTSW 11 102354423 missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102356258 missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102353867 missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102356484 missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102361419 start gained probably benign
R7582:Slc4a1 UTSW 11 102352577 missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102353257 missense possibly damaging 0.94
RF006:Slc4a1 UTSW 11 102356716 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACCTGCCTCTGATACTCCAAC -3'
(R):5'- GAGCATTTCCACCCAATTCC -3'

Sequencing Primer
(F):5'- GCCTCTGATACTCCAACACTCC -3'
(R):5'- CCAATTCCCTGCCCCAG -3'
Posted On2016-06-15