Incidental Mutation 'R5103:Gm8909'
ID392516
Institutional Source Beutler Lab
Gene Symbol Gm8909
Ensembl Gene ENSMUSG00000073402
Gene Namepredicted gene 8909
Synonyms
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36164443-36168537 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 36161685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040467] [ENSMUST00000097335] [ENSMUST00000173353]
Predicted Effect probably benign
Transcript: ENSMUST00000040467
SMART Domains Protein: ENSMUSP00000036092
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 26 204 5.9e-96 PFAM
IGc1 223 294 8.23e-23 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090537
SMART Domains Protein: ENSMUSP00000088025
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 105 173 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097335
SMART Domains Protein: ENSMUSP00000094947
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 7.3e-96 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173025
SMART Domains Protein: ENSMUSP00000133655
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 148 216 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173353
SMART Domains Protein: ENSMUSP00000133663
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 3.9e-93 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174752
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Gm8909
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Gm8909 APN 17 36165354 critical splice donor site probably null
IGL00534:Gm8909 APN 17 36168129 missense probably damaging 1.00
IGL02312:Gm8909 APN 17 36165407 missense probably benign 0.01
IGL03346:Gm8909 APN 17 36168109 missense probably damaging 1.00
H8441:Gm8909 UTSW 17 36167982 missense possibly damaging 0.84
R0005:Gm8909 UTSW 17 36162192 unclassified probably benign
R0078:Gm8909 UTSW 17 36165461 missense possibly damaging 0.95
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0553:Gm8909 UTSW 17 36168057 missense probably damaging 1.00
R0670:Gm8909 UTSW 17 36168098 missense possibly damaging 0.74
R1718:Gm8909 UTSW 17 36161784 unclassified probably benign
R1937:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R2571:Gm8909 UTSW 17 36167661 missense possibly damaging 0.66
R4393:Gm8909 UTSW 17 36161969 unclassified probably benign
R4396:Gm8909 UTSW 17 36161969 unclassified probably benign
R4409:Gm8909 UTSW 17 36165850 missense possibly damaging 0.53
R4505:Gm8909 UTSW 17 36161480 unclassified probably benign
R4506:Gm8909 UTSW 17 36161480 unclassified probably benign
R4507:Gm8909 UTSW 17 36161480 unclassified probably benign
R4579:Gm8909 UTSW 17 36161757 unclassified probably benign
R4684:Gm8909 UTSW 17 36165858 missense possibly damaging 0.90
R4740:Gm8909 UTSW 17 36167556 missense probably damaging 1.00
R5087:Gm8909 UTSW 17 36165416 nonsense probably null
R5275:Gm8909 UTSW 17 36161675 splice site probably null
R5425:Gm8909 UTSW 17 36168485 missense probably damaging 1.00
R6155:Gm8909 UTSW 17 36167507 missense possibly damaging 0.93
R6727:Gm8909 UTSW 17 36165730 missense probably damaging 1.00
R6852:Gm8909 UTSW 17 36168073 missense possibly damaging 0.52
R7985:Gm8909 UTSW 17 36167553 missense probably damaging 1.00
R8316:Gm8909 UTSW 17 36168262 missense unknown
R8872:Gm8909 UTSW 17 36165401 missense probably benign 0.00
Z1177:Gm8909 UTSW 17 36165712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACTTCCAACATGGGGTC -3'
(R):5'- TTCCTGATTGCCAGAAGGG -3'

Sequencing Primer
(F):5'- TTCCAACATGGGGTCACTCAC -3'
(R):5'- AAAGGCTTCTGGGGGCATG -3'
Posted On2016-06-15