Incidental Mutation 'R5103:Mrpl2'
ID392518
Institutional Source Beutler Lab
Gene Symbol Mrpl2
Ensembl Gene ENSMUSG00000002767
Gene Namemitochondrial ribosomal protein L2
SynonymsCGI-22, Rpml14, MRP-L14
MMRRC Submission 042691-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R5103 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46646229-46650139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46650038 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 286 (R286Q)
Ref Sequence ENSEMBL: ENSMUSP00000109057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002844] [ENSMUST00000003642] [ENSMUST00000043464] [ENSMUST00000113429] [ENSMUST00000113430] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably benign
Transcript: ENSMUST00000002844
AA Change: R288Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000002844
Gene: ENSMUSG00000002767
AA Change: R288Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Ribosomal_L2 84 166 3.44e-29 SMART
Ribosomal_L2_C 177 298 1.32e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003642
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043464
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113429
SMART Domains Protein: ENSMUSP00000109056
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 84 166 1.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113430
AA Change: R286Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109057
Gene: ENSMUSG00000002767
AA Change: R286Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 82 164 1.6e-31 PFAM
Pfam:Ribosomal_L2_C 175 279 5.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132790
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144966
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL2 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 12q. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,189,262 I591V probably benign Het
Agbl5 G A 5: 30,894,001 R518H probably damaging Het
Agfg1 T C 1: 82,893,567 S486P probably damaging Het
Arhgap18 A G 10: 26,869,982 D283G probably damaging Het
Asb1 A G 1: 91,552,344 N162S possibly damaging Het
BC037034 A G 5: 138,262,300 V288A probably benign Het
Capn1 A G 19: 6,009,110 Y274H probably damaging Het
Cdk5 A T 5: 24,422,835 V30E probably damaging Het
Cep290 T G 10: 100,539,020 L1376W probably damaging Het
Crybg1 T A 10: 43,997,948 T1055S probably damaging Het
Cyp2c70 A G 19: 40,160,632 Y357H probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Eml6 T A 11: 29,850,905 E367V possibly damaging Het
Emp1 A G 6: 135,381,075 T140A probably benign Het
Ergic3 T C 2: 156,008,625 V74A probably benign Het
Fancm A T 12: 65,105,858 L1029F probably damaging Het
Fank1 C A 7: 133,876,841 C210* probably null Het
Fbxo31 T C 8: 121,552,362 D462G probably damaging Het
Frem1 G A 4: 82,991,612 A736V probably benign Het
Fshr T C 17: 89,097,368 T56A possibly damaging Het
Gm5901 A T 7: 105,377,382 probably null Het
Gm8909 T C 17: 36,161,685 probably benign Het
Golga2 A G 2: 32,303,746 E458G probably benign Het
Grik2 T A 10: 49,496,109 I335F probably benign Het
Grin1 T A 2: 25,310,421 M230L probably benign Het
Gtf2f1 C T 17: 57,004,519 G297D probably damaging Het
Hacd1 T C 2: 14,040,913 T136A probably damaging Het
Hdac5 T A 11: 102,196,283 S24C probably damaging Het
Jtb T C 3: 90,232,087 probably benign Het
Kif1a C T 1: 93,046,696 G979E probably damaging Het
Mark2 T C 19: 7,284,503 M345V probably damaging Het
Mfsd14b A G 13: 65,087,093 V90A possibly damaging Het
Micu1 T C 10: 59,788,984 Y283H possibly damaging Het
Mmp2 C T 8: 92,831,785 R161* probably null Het
Msh5 T C 17: 35,029,239 I783V possibly damaging Het
Myo3b T A 2: 70,096,403 F65I probably benign Het
Nat10 C A 2: 103,757,260 V37L probably damaging Het
Nlrp1a T A 11: 71,099,526 T967S probably damaging Het
Nolc1 A T 19: 46,081,664 K291* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr347 A T 2: 36,734,668 T116S probably benign Het
Olfr52 C A 2: 86,181,616 R165L probably benign Het
Olfr926 G T 9: 38,877,576 M133I probably damaging Het
Paip1 A G 13: 119,437,979 E70G possibly damaging Het
Palmd T A 3: 116,927,421 E127V probably damaging Het
Paqr6 T A 3: 88,367,717 C262* probably null Het
Pdcd11 A G 19: 47,124,454 H1301R probably benign Het
Plce1 C A 19: 38,767,215 D1896E probably damaging Het
Ppib A G 9: 66,061,465 probably null Het
Pzp C T 6: 128,502,229 V654M probably benign Het
Rab26 T C 17: 24,534,097 probably benign Het
Recql4 A G 15: 76,706,756 L468P probably damaging Het
Retreg1 C T 15: 25,968,454 Q65* probably null Het
Rhpn1 C T 15: 75,714,215 T659I possibly damaging Het
Slc12a5 C A 2: 164,992,433 H791Q probably damaging Het
Slc40a1 G A 1: 45,918,995 Q93* probably null Het
Slc4a1 T C 11: 102,353,261 M681V possibly damaging Het
Slc6a9 T A 4: 117,868,155 F493L probably benign Het
Smc2 A G 4: 52,459,033 E476G probably damaging Het
Smco4 G T 9: 15,544,794 E59* probably null Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stat4 T A 1: 52,071,895 L167Q probably damaging Het
Sult1e1 C A 5: 87,576,232 V289L probably benign Het
Tbc1d4 C A 14: 101,458,882 E877* probably null Het
Tenm4 A T 7: 96,842,957 I1033F probably damaging Het
Tppp2 T A 14: 51,919,452 F95L probably benign Het
Vmn2r41 G A 7: 8,138,342 L708F probably benign Het
Washc5 G A 15: 59,350,169 P126L probably damaging Het
Xkr4 T C 1: 3,670,688 I221V probably benign Het
Xkr5 T C 8: 18,933,643 R628G probably benign Het
Zfp207 T C 11: 80,391,910 L233P probably damaging Het
Zfp827 T A 8: 79,070,403 C373S probably damaging Het
Other mutations in Mrpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Mrpl2 APN 17 46649983 missense probably damaging 1.00
IGL01757:Mrpl2 APN 17 46648257 missense probably damaging 1.00
IGL02292:Mrpl2 APN 17 46648231 unclassified probably benign
IGL03177:Mrpl2 APN 17 46649037 missense probably damaging 0.99
IGL03326:Mrpl2 APN 17 46649927 missense possibly damaging 0.78
R1620:Mrpl2 UTSW 17 46647499 missense probably benign 0.28
R2567:Mrpl2 UTSW 17 46647501 missense probably benign 0.17
R4573:Mrpl2 UTSW 17 46649041 missense possibly damaging 0.89
R5102:Mrpl2 UTSW 17 46650038 missense probably benign 0.11
R5283:Mrpl2 UTSW 17 46649066 missense possibly damaging 0.83
R5405:Mrpl2 UTSW 17 46649110 critical splice donor site probably null
R6199:Mrpl2 UTSW 17 46649086 missense probably damaging 1.00
R6225:Mrpl2 UTSW 17 46649909 missense probably damaging 0.98
R6232:Mrpl2 UTSW 17 46647430 missense probably benign 0.01
R6841:Mrpl2 UTSW 17 46647456 missense probably benign 0.31
R7170:Mrpl2 UTSW 17 46648255 missense probably damaging 1.00
R7784:Mrpl2 UTSW 17 46648591 splice site probably null
R7831:Mrpl2 UTSW 17 46648672 missense possibly damaging 0.93
R8284:Mrpl2 UTSW 17 46647509 nonsense probably null
R8938:Mrpl2 UTSW 17 46646312 unclassified probably benign
X0018:Mrpl2 UTSW 17 46648351 missense probably damaging 1.00
Z1088:Mrpl2 UTSW 17 46647478 missense probably null 0.14
Predicted Primers PCR Primer
(F):5'- ACCCAGAGTAGTGTTCCCAAC -3'
(R):5'- AGTGCCTTCCCATTTCCCAAAG -3'

Sequencing Primer
(F):5'- CCACCGGTGCGTTCTTG -3'
(R):5'- GGAGGTCATTTCTGCCCC -3'
Posted On2016-06-15