Incidental Mutation 'R5104:Nelfcd'
ID392536
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
MMRRC Submission 042692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5104 (G1)
Quality Score115
Status Not validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174426366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 475 (V475A)
Ref Sequence ENSEMBL: ENSMUSP00000104703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably benign
Transcript: ENSMUST00000016397
AA Change: V491A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: V491A

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109075
AA Change: V475A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: V475A

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,240 V883A probably benign Het
3632451O06Rik A T 14: 49,773,472 D259E possibly damaging Het
Adarb1 A G 10: 77,322,287 F109L probably damaging Het
Ano4 T A 10: 89,068,112 Q241L possibly damaging Het
Apof C T 10: 128,269,618 R214* probably null Het
Atl2 A T 17: 79,852,617 S47T probably benign Het
Azgp1 T G 5: 137,987,553 I146S probably damaging Het
Bicral G A 17: 46,801,256 T1006I probably damaging Het
Ccdc110 A T 8: 45,942,692 N540I probably damaging Het
Ccdc77 T C 6: 120,348,385 probably null Het
Cxcr5 G T 9: 44,513,319 P347Q probably benign Het
Cyp4a14 T G 4: 115,495,929 H62P probably damaging Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Ehd3 A G 17: 73,827,447 N267S probably benign Het
Eno4 A G 19: 58,945,541 Y58C probably benign Het
Fat2 A G 11: 55,278,988 Y2982H possibly damaging Het
Frmd3 C A 4: 74,145,078 A214D probably damaging Het
Gabrg1 A C 5: 70,774,432 S323A probably damaging Het
Gbp9 T C 5: 105,080,141 I592V probably benign Het
Gje1 G A 10: 14,716,718 Q107* probably null Het
Gm29609 T C 5: 31,154,294 probably null Het
Gpam A T 19: 55,093,986 F78I probably benign Het
Hecw1 T C 13: 14,340,792 R252G probably damaging Het
Hsd3b5 T A 3: 98,619,276 S285C probably damaging Het
Ighv1-74 T C 12: 115,802,887 K37E possibly damaging Het
Igkv8-34 T C 6: 70,044,154 D108G probably damaging Het
Il6st C G 13: 112,488,648 T266S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kit A G 5: 75,615,478 T307A probably benign Het
Kmt2b G A 7: 30,569,840 R2552C probably damaging Het
Krt4 T A 15: 101,920,323 R369W probably damaging Het
Larp4 T A 15: 99,986,083 M8K probably damaging Het
Lrit3 T A 3: 129,788,391 H528L possibly damaging Het
Mia3 A G 1: 183,338,132 L157S probably damaging Het
Naa16 A T 14: 79,384,700 Y32* probably null Het
Nbea A G 3: 56,079,927 Y381H probably damaging Het
Noxa1 T C 2: 25,086,234 I347M probably benign Het
Olfr131 A T 17: 38,082,283 S232T possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr699 A T 7: 106,790,332 F223Y possibly damaging Het
Olfr747 T A 14: 50,680,702 K311* probably null Het
Pabpc1l T A 2: 164,043,587 I420K probably benign Het
Pi4ka C T 16: 17,281,050 C1990Y probably damaging Het
Pkhd1 T A 1: 20,585,191 Q223L probably damaging Het
Pkm G T 9: 59,668,681 probably null Het
Proz A G 8: 13,066,931 D161G probably damaging Het
Ptprb C A 10: 116,322,459 H765Q probably benign Het
Rffl A T 11: 82,812,793 C101* probably null Het
Rfx5 C T 3: 94,955,140 T36I probably benign Het
Rnase12 C A 14: 51,056,904 C106F probably damaging Het
Samd3 T C 10: 26,263,788 S273P possibly damaging Het
Simc1 A G 13: 54,526,362 D841G probably benign Het
Slc8a3 T C 12: 81,214,134 E607G probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Snx25 T C 8: 46,068,166 *143W probably null Het
Taf15 A G 11: 83,487,396 Y154C probably damaging Het
Tgfb3 A G 12: 86,058,982 V333A possibly damaging Het
Tiam1 A G 16: 89,818,041 S2P probably benign Het
Tmed11 T C 5: 108,777,276 probably null Het
Tmtc4 T C 14: 122,932,845 D585G probably damaging Het
Trabd2b T C 4: 114,406,917 S34P probably benign Het
Trbv13-2 T C 6: 41,121,811 Y107H probably damaging Het
Tuba3a A G 6: 125,282,384 V115A probably benign Het
Tut1 A G 19: 8,959,334 E174G probably benign Het
Ubr3 T A 2: 69,938,256 M469K probably damaging Het
Vcan C T 13: 89,657,472 probably benign Het
Wapl C T 14: 34,692,059 Q293* probably null Het
Wdr24 A G 17: 25,824,591 H129R probably damaging Het
Wrn A T 8: 33,267,867 probably null Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
R7382:Nelfcd UTSW 2 174423383 missense probably benign 0.00
R7532:Nelfcd UTSW 2 174426396 missense probably damaging 1.00
R7545:Nelfcd UTSW 2 174423978 splice site probably null
R7766:Nelfcd UTSW 2 174426832 missense possibly damaging 0.87
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTAGAAGCTGACAGGTGGTG -3'
(R):5'- AGCTTCTCCAGACATTTGCGG -3'

Sequencing Primer
(F):5'- TGTCCCCATCGGCAGTAAG -3'
(R):5'- TTTGCGGATATAACTGACCACCG -3'
Posted On2016-06-15