Incidental Mutation 'R0443:Gapvd1'
ID39255
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 038644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0443 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 34704621 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
Predicted Effect probably benign
Transcript: ENSMUST00000028224
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102800
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113099
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113101
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113103
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113111
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128855
SMART Domains Protein: ENSMUSP00000129138
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137528
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201772
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b G T 5: 25,848,411 R246L probably damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Caskin1 C T 17: 24,505,400 A1054V probably damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cnot6l T G 5: 96,091,745 probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Ctgf T C 10: 24,595,803 probably benign Het
Cux2 C T 5: 121,887,437 R56H possibly damaging Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Epg5 T C 18: 77,955,903 probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gsdma2 C T 11: 98,657,688 T255I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Ms4a6b A G 19: 11,521,680 I53V possibly damaging Het
Mtf1 C T 4: 124,824,282 probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nop9 A G 14: 55,753,748 S621G probably benign Het
Olfr378 A G 11: 73,425,755 V76A probably damaging Het
Olfr459 T A 6: 41,771,895 I135F possibly damaging Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Pacs1 A T 19: 5,272,583 Y102* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Pih1d2 A G 9: 50,621,103 R170G possibly damaging Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Pknox1 A G 17: 31,592,219 S156G probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Slc25a40 T A 5: 8,447,348 S229T probably benign Het
Slc43a2 T C 11: 75,544,667 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tonsl T C 15: 76,639,684 S39G probably benign Het
Trove2 A G 1: 143,765,923 probably benign Het
Trpc2 A G 7: 102,093,520 probably benign Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Uvssa A G 5: 33,388,824 R180G possibly damaging Het
Vmn1r197 T A 13: 22,328,071 I54K possibly damaging Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Zbtb49 T C 5: 38,200,830 E693G probably benign Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
R7418:Gapvd1 UTSW 2 34725118 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTGCGAACCAATCTCTCAGGGTATG -3'
(R):5'- AGGTAGATGCTGCTCCCTCTAAGTG -3'

Sequencing Primer
(F):5'- CAAAGTTTGGCAACCTGGC -3'
(R):5'- CTCCCTCTAAGTGGAGTGAAAAATC -3'
Posted On2013-05-23